Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17017

FASTA Sequence
Unigene ID: UN17017Length: 2144 SSRSNP
TTTTTCTGATGGCAAAAATCGTAAACAGGTACCCATGAAGAAAGAAAATGGTCAAACAGCTTTGGTGCCACTTTTCCAGAGTCAAG
AAACTTTTTCCGGGAAGGTTTGCATTGAACCATATCAAGAGAAAAAGGTGGAGCATAATGGTGTCAAAGTTGAGCTTCTTGGTCAA
ATAGAAATGTACTTTGACAGAGGAAACTTCTATGACTTCACTTCCTTGGTTCGTGAATTGGATGTCCCTGGAGATATATACGAGAG
AAAGACATACCCTTTCGAGTTTCCAACTGTCGAGATGCCATATGATACATACAATGGTGTCAATGTGCGCCTAAGAGATGTCCTCA
AAGTTACCGTCACTCGTGGCTACTCTGGAAGCATCGTGGAGTACCAGGAATTCATGGTTCGGAACTATGCTCCACCTCCTCCAATT
AATAACAGCATCAAGATGGAAGTTGGGATAGAGGATTGCCTGCACATTGAGTTTGAGTACAACAAAAGCAAGTATCACCTAAAAGA
TGTCATCCTTGGCAAAATATACTTTCTTCTTGTGAGGGTCAAGATGAAGAATATGGATCTTGAGATACGGAGGTGGGAATCAACAG
GTGCTGGTGCTAATACTCATGTCGAGACAGAAACACTTGCCGAATTTGAGTTGATGGATGGAACCCCAGTTAGAGGTGAGTCAATA
CCTGTAAGACTGTTTCTTGCCCCGTACGATCTTACACCAACGCATCGCAACATTAACAACAAATTCAGCGTCAAGTATTATCTGAA
TCTTGTACTGGTTGATGAAGAGGATCGCAGATACTTCAAGCAGCAAGAAATCACTTTGTACAGGTTGAAGGCAGACACATCAGCTG
TTTGAGTCTTGTGTAAAGCCTTTTTAGACTTTTTGGTACTCAGATTTTAGCTAAAGACTTTGTTATTTGGGTTTGGAAGTTAGAAT
GAATAATAGTTTGGTCATTGATCAAAGTTGTCTGGATTCTGGTTTACTTTTCATTGGTAAATGTCTGAAGTTTTACAAACTTTTAA
ACACATTCTGGAAAAGCCAAACCTCTAAATGCCACTACCTGAATTCGACAGAGATACAAAACTGGATATAAGACCTGAGAGGAGAA
GTTAGTCTTCTTCAGATTCAATAGGAAGGCCTTCCTTGCTCCATGTGTAGATTCCACCTTCAAGGTGGAATACGTTCTTATAGCCG
TTCAGGACCAGAACATAAGCAGCTATGAGAGACCTAGATTGTTGGCCTTCAGGGAGATTCTGAGTCGGCTTCATAGTCCCTGCGGA
AGAACAAGCTACTATTATCTTTGCCTCTTTGTCAAGTTTAGCTTCTACACTTTTGATAAACTCTGGATTCTCTTCTGTGCCAGAGA
AGATACCGAAGAAAGCAAATCCAAGACGACGAGCTATGTCCCATGGCGTCCATTCTCGTATCAGCCTGTACATCTCCACATTGATA
GCTCCCGGAGGATGACCCTCCTTGTACTCAGCCTCTGGTCTAACATCAAGAATCACAAAGTTGTTCTCTTTCTGTAACCGTAGAGC
TTCCTTCACGTCCACACTTCTCACCCTTTTCTCCAGTAGAAGCTCTCTCTTCTGTCTCCAATCGACTTCAGCTGCTGGTTTGTCAG
GTTTCGTTGCAGCGCTTCGAATAGTCAGAAGCGATGATGAAGAAGAAGAAGCAGGGGATCTAACTCCAGCTGAGAACAGAGTGTTT
CCGGCGAGTTTGACACGTAAAGCTTGCGACGAAGATGGATAACTTGAGCTGCGATAAGGGGTGGCAATAGAAGTAAGTGAAGCCAT
CTTCTTCTGAGATATTTTTTTTGCTGGAAAATGAGAGAATTTAAATGCAGGATGATGGAAAGACAGAAAGAGACCTGCTGGTTTGT
CAGGTTTCGTTGCAGCGCTTCGAATAGTCAGAAACGATGATGAAGAAGAAGAAGAAGCAGGGGATCTAACTCCAGCTGAGAACAGA
GTGTTTCCGGCGAGTTTGACACGTAAAGCTTGCGACGAAGATGGATAGCTTGAGCTGCGATAAGGGGTGGCAATAGAAGTAAGTGA
AGCCATCTTCTTCTGAGATATTTTTTTGCTGGAAAATGAGAGAATTTAAATGCAGGATGATGGAAAGACAGAAAGAGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869547 hypothetical protein ARALYDRAFT_913758 [Arabidopsis lyrata subsp. lyrata]14041e-152
NP_194499 vacuolar protein sorting-associated protein 26 [Arabidopsis thaliana]13994e-152
XP_002865977 hypothetical protein ARALYDRAFT_331709 [Arabidopsis lyrata subsp. lyrata]13412e-145
NP_001031732 vacuolar protein sorting-associated protein 26 [Arabidopsis thaliana]13403e-145
NP_200165 vacuolar protein sorting 26A [Arabidopsis thaliana]13376e-145

Swiss-Prot top hits (Blast detail)Scoree value
Q9T091 Vacuolar protein sorting-associated protein 2613992e-153
Q55CA0 Vacuolar protein sorting-associated protein 268642e-091
Q6TNP8 Vacuolar protein sorting-associated protein 26A8435e-089
Q6AY86 Vacuolar protein sorting-associated protein 26A8382e-088
Q0VD53 Vacuolar protein sorting-associated protein 26A8354e-088

TrEMBL top hits (Blast detail)Scoree value
Q2V3E3 Putative uncharacterized protein At4g27690.213402e-145
Q9FJD0 Vacuolar sorting protein-like13374e-145
B9DHG4 AT4G27690 protein13357e-145
A9PCL0 Predicted protein13161e-142
B9N808 Predicted protein13052e-141

Arabidopsis top hits (Blast detail)Scoree value
AT4G27690.1 VPS26B (VACUOLAR PROTEIN SORTING 26B)13991e-154
AT4G27690.2 VPS26B (VACUOLAR PROTEIN SORTING 26B)13401e-147
AT5G53530.1 VPS26A (VACUOLAR PROTEIN SORTING 26A)13372e-147
AT4G27700.1 rhodanese-like domain-containing protein9904e-107
AT3G08920.1 rhodanese-like domain-containing protein1293e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
95  15%
 
125  15%
 
810  30%
 
64  12%
 
117  21%
 
72  6%

Unigene MembersMember information