Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17018

FASTA Sequence
Unigene ID: UN17018Length: 1669  SNP
GTGCAAAGACGAAGCTGTAACTGTAAGTAGAAATACATCACGTCATGTGGGCAGTCAAATCTCAAATCTCTTTAAAAAGTTTTATA
CAAGAGGAGAGAGACAAACTTGTGTGCTTCCTCCATCACTTTCCGACTCTAAAACAGATGGAATTTTGTTCAAAAAGAAACCTGGA
GAATCTCAAATCCCAAACAAAAGCCAAAGTTTCAGGAAACGGATGACAAAAATAGGAAGGTAAAAGCTGATTTTGTTGCGTCAGTG
GGCGATACATATCTTTTTTTTTTGGAATACGGATGATATGATAATAAATACTCAAAAGTTCCTTATGCTGAAAATACAATCAGCCT
CACAAGCCACGAGGGAAGTTGTTGATCTGTCCTTCCTCCAGTACATCTTTTCCGTTTACTTTGTACCCAATCCTCATGCGCATCAC
AAGAGATTTCTTTCCGTGCTGGCTGTTAGTGACTTTCAGATTCTGCATGATGTTACCGCTTGCCGGGAGTGTGTTACTGCTTGCTG
GATCCAAGTGCAGCTGGAGGAACTTTGGAACAGCAGCCTGGAAGATAAAATCTGTGAAAGTATTAGGAGATAGATTTATAAAAGTG
GCTTGGACATTTGTTGTTTGTGGGTTCTCTGATGGCTTTGAGAAGGTGAACTCAATCTTCAAGGTGCTGCTCTCGTATGCAACAAT
AGGTGGATATGCTGGACCATTGGTTGCTTCCTTCGATGGGCTTGGAGAAAGACCATCTAACAAATCAAACATACCACCAGCAGAAG
CAGTCGTTGCTACGTGAGGTGGAGCTGGTGAAGAGAGTGTGTCTAGCGCAGTAGAAGGACTATTGTTAATGGCAGCTGTCGATAAC
AAATCAATTGATGATGTGTTGTTTTGTGCCGGAGAAGGTGTTCCAATTGATAAAATATCCATCAACAGATCTGCGCCGGCTTTTGG
ACCCGGGGCTGCACCAGATTGTGCCGGCGATGATCCTAAGTCAACACCAAGAAGATCCTGAAGGAAATCTGCACCAGATGAACTAG
GTGCAGCCATGATATCGTCAGAACCCAGGTCCAGCAAATCCACTAGTGGAGCTGCAGCAACACCATTTGGAATACTAACTGAAGGT
TTGGCCATTGTTGAAACTGACGCAGGCAAAGAGCCAGCCCTCCTCACATTGAAGGTAGCCTCATCTAGCACCGGCATTCTCTCAAC
TAGAGAAGACCTGATATTTTTATGCCTGTCAACAATAGAATTGAATTCAATAGCTCTCTGCTGCATTTCAAGGAGAAGGCTCCCTT
TCTGCTTCACAATTATATCTTTAATCCTCTCTGAGATAGTAGGAAAGCGGGATGACAGCTTCAGTAGAGCAACCAATGCCATCGCT
TTTGTAGTCATATCTGAGTTATGGCGAGTAATGGCTTCCTCGATTACGTCCACTGCATCACTTTCCGTTACCGTTATTGGATCTTC
AATACCAAGCATCCCCACATTGTTAACCAGTAAATCACCATATTCCCCAATGCACCAAACCGCCACTCGGACAAGGGTCTCCTGTT
CTGAATATGTCATGACTGCTTTGTATAATGCTCTGACTGTATATCCGTGAAGCTCTGATGCATTGCTTATGACAACAATCAGTGCA
TGCCACACATCATCTTTCACAAACTTTCCAGCCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002890600 GAMMA-ADAPTIN 1 [Arabidopsis lyrata subsp. lyrata]19612e-217
NP_173802 AP-1 complex subunit gamma-1 [Arabidopsis thaliana]19334e-214
CAB39730 adaptor protein complex AP-1 large subunit [Arabidopsis thaliana]19325e-214
AAD28247 gamma-adaptin 1 [Arabidopsis thaliana]19182e-212
XP_002309097 predicted protein [Populus trichocarpa]15509e-170

Swiss-Prot top hits (Blast detail)Scoree value
O43747 AP-1 complex subunit gamma-14251e-040
Q5R5M2 AP-1 complex subunit gamma-14222e-040
P22892 AP-1 complex subunit gamma-14187e-040
O88512 AP-1 complex subunit gamma-like 23381e-030
O75843 AP-1 complex subunit gamma-like 23156e-028

TrEMBL top hits (Blast detail)Scoree value
Q84K16 Putative gamma-adaptin19332e-214
Q9XFS0 Gamma-adaptin 2 (Adaptor protein complex ap-1 large subunit)19323e-214
O81227 Gamma-adaptin 119181e-212
B9HC63 Predicted protein15506e-170
B9S4M0 AP-1 complex subunit gamma-2, putative15443e-169

Arabidopsis top hits (Blast detail)Scoree value
AT1G23900.1 GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter19341e-216
AT1G23900.2 GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter19341e-216
AT1G60070.1 binding / clathrin binding / protein binding / protein transporter15111e-167
AT1G23940.1 adaptin family protein3962e-038

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  17%
 
122  9%
 
114  17%
 
95  22%
 
66  26%
 
82  9%

Unigene MembersMember information