Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17053

FASTA Sequence
Unigene ID: UN17053Length: 981  SNP
GATTGTTGTGTAGGGTTCCAACCAGATTATCTGCAACGAAACAAAATGGCTTTGGCTGGTCGTATCAGATCCGGGATCTCCTTCTT
CAAGACCATCTCCGTCTCAGATGCTAGATCTTCGCTTATCCCTTCGCTGAGAGATTATGCAACAGCTTCTGCTCAGAAAACCGGCA
ACGTTAAGGTGCCTGTGGCTTTGGTTGGTGAATCTGGCAACTTTGCATCGTGGCTGTACATTGCAGCTGTGAAAATGAACTCCTTG
GAAAAGATTGAGTCCGATCTCTCTGAGCTGGTTGAGGCTATGAAGACAAGCCCTACTTTTTCACAGTTCACTAAGGATCCCTCTGT
TCCGAGAGAGACAAGATTGGCTGCTATCGTTGATGTTTGTGACAAAGCAAAGTTTGCTGAACCCACCAAGAACTTCCTCTCTTTGT
TAGCTGAGAATGGGAAGCTGAAGAACTTAGACGTGATTGTGAAAAAATTCATGCAGCTGACGACGGCACATAGGGGAGACGTCAAG
GTTTTGGTTACCACAGTCATGCCGCTACCACCTGCTGAGGAGAAAGAGCTTAAGGAGACACTACAGGAGATAATTGGAGAAGGGAA
GAAAGTTACTGTGGAACAAAAGATTGATCCGAGTATATATGGAGGGCTAATAGTAGAGTTTCAACAAAAGGTGTTGGACATGTCTA
TCAGGACAAGAGCACAGCAGATGGAGAGACTCCTCCGTGAACCTGTTGACTTCACCAACCTCTGAAGATTTCCCCTAAGAAACATG
CTTTCTGATTTGCTACAAAACCAGTTGACAAATAAAATATGACCCTCCTCCTGGGGAAACAATCAATACAAGACACAAATTTCATT
GCATTTTACAATTGTTGTTTTGCTTCAAAATAAGCTTTTGGAGATATCAATCAATGAGATTATTTTTTTTTTTTGTTTTGTGTTTA
CATTAATTTTGGTAACACAATGATAATGAGTCACG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABL97953 hydrogen-transporting ATP synthase [Brassica rapa]10227e-109
XP_002873614 AT5g13450/T22N19_100 [Arabidopsis lyrata subsp. lyrata]10227e-109
NP_196849 ATP synthase subunit O [Arabidopsis thaliana]10031e-106
AAK55728 AT5g13450/T22N19_100 [Arabidopsis thaliana]10031e-106
BAA13600 delta subunit of mitochondrial F1-ATPase [Arabidopsis thaliana]9814e-104

Swiss-Prot top hits (Blast detail)Scoree value
Q96251 ATP synthase subunit O, mitochondrial10035e-108
P22778 ATP synthase subunit O, mitochondrial6944e-072
Q5RD23 ATP synthase subunit O, mitochondrial3432e-031
Q2EN81 ATP synthase subunit O, mitochondrial3422e-031
P48047 ATP synthase subunit O, mitochondrial3404e-031

TrEMBL top hits (Blast detail)Scoree value
A1YMZ4 ATP synthase10225e-109
Q9SXX1 ATP synthase6865e-070
C6SWQ6 ATP synthase6596e-067
Q2V382 ATP synthase6588e-067
C6TCP7 ATP synthase6542e-066

Arabidopsis top hits (Blast detail)Scoree value
AT5G13450.1 ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative10044e-109
AT5G13450.2 ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative6594e-069

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
64  22%
 
84  22%
 
114  22%
 
72  11%
 
92  11%
 
121  6%
 
181  6%

Unigene MembersMember information