Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17062

FASTA Sequence
Unigene ID: UN17062Length: 1171  SNP
GGACTCAAATAAGCAACACAAACTTTTCTAATCAAGAATAAGCAACACAAACTTTTCTAATCAAGAATGTGAAGAAATATCACATA
TAGAAATCTTATTTCAAAAGTTATCATTATTCGTGTATAGAGAATCATAGGAAGTGCAAATTCTTTGAAGGGAGAAACAGAGGCTT
CTGAGAGATGAAATATGAATATAAAACAATTATTCTGCAGGCCCTAGAGAACCATCTTCTTCCTGCTTCAAGGTGTCTTGACCTTG
GGACGTGCAGGGAGTAGCTGATAACAAGAGATAAGAGAGGTGGTAAAACCGAGAGCGCCAGTGACGCGAGGAGTAACAGTCTTTGG
AGCTAACTGAAGCAGACCAATGGCTACAACAATGTCTATGCTTGTTTTAACCAAAGCTAGAGTTCTGTCATTGGATTTCTGAAGCT
TAGCACGATACACCTCATCATGCTGCTTTTCACCACCTTTGAGTTCCTTCTCCATCTTCTTGATAGATGAAGAGAGCCTTCCAAGC
TCACCAATCTCGACTGCTGTTGTACAGACAGATGATCCAAGCCAGCAGAAAAGTGATATACGTCCAAGCAACTCAGTTCGTTCTTT
GTTCTTGTATATGCCGGATCTACCAAGCCAAACGATTTGATCAAGAAACAAGAAGGTAGACAAGAGCGCATTCTTGGACTTCCCGA
GTAAGACAAGAGGAAGTGGGGTCCCTTTAGGCACAGGGCTGATTAGACCGTGAAAATCATTGACAAACTTGAAAAGACGAAAGACT
TTTCTAGCCAAGCTGGTGTTTTTGTCAACAGTTTGAGCAGTACCAGGCTGCCCACCGCTCAAGAACTTGGAACCATATTGTATAGC
TCTGCATATCTTATCTCTAGCCTCAGCTTTGTTCAAGTACAGAACTATAAGAGCTAGCTCGGCTCTGGTCAAATCTAACGTTGTCA
TCTTCTCTCCTTAATGATCTCTATTAGGATCCTGTAGATTATACAAAATGAGATCGATTCAGGTTTCCAAGACGCAAACACACAAA
GGATTAAAGATAGAAAGCTATCGAATTTTCAAGAGAAGGGATCCAGTGCCTTAATATATGGGAAGATCGTGAGCTGTTCTTTCTTA
TTATGTATGTCATTATCTTCTTACTCGTTTACGTCATCTAAAGATGAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_191666 peroxisomal membrane protein 11E [Arabidopsis thaliana]10802e-115
CAD58676 peroxisomal membrane protein PEX11-2 [Arabidopsis thaliana]10802e-115
XP_002880194 peroxisomal biogenesis factor 11 family protein [Arabidopsis lyrata subsp. lyrata]10327e-110
NP_566055 peroxisomal membrane protein 11D [Arabidopsis thaliana]10319e-110
XP_002320762 predicted protein [Populus trichocarpa]10121e-107

Swiss-Prot top hits (Blast detail)Scoree value
Q84JW1 Peroxisomal membrane protein 11E10986e-119
O80845 Peroxisomal membrane protein 11D10314e-111
Q9LQ73 Peroxisomal membrane protein 11C9785e-105
Q5VRJ8 Peroxisomal membrane protein 11-58782e-093
Q10SM7 Peroxisomal membrane protein 11-18665e-092

TrEMBL top hits (Blast detail)Scoree value
A9PJM0 Putative uncharacterized protein10121e-107
B9IC69 Predicted protein10121e-107
A9PC03 Predicted protein10092e-107
B9RDK6 Peroxisomal biogenesis factor, putative10012e-106
B6ZK00 Peroxisomal biogenesis factor 11 family protein9752e-103

Arabidopsis top hits (Blast detail)Scoree value
AT3G61070.1 PEX11E10994e-120
AT3G61070.2 PEX11E10994e-120
AT2G45740.1 PEX11D10323e-112
AT2G45740.2 PEX11D10323e-112
AT2G45740.3 PEX11D10323e-112

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
125  14%
 
611  30%
 
915  41%
 
81  3%
 
113  8%
 
202  5%

Unigene MembersMember information