Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17075

FASTA Sequence
Unigene ID: UN17075Length: 952  SNP
GGGCAAAGACAGAAAACAAATCAGCTCAGACCTTCTCCGCCTCTAGGAAGGTTTTAGTTTCGCCTATTCATTGACCGGAAGTCCAG
AATCGGACCATACCGTCGAAGATGGCTCCGATCATCAGATCTAGCCCAGCTCTCGCTTTCCTCGTTTTGCAGATTAGCTTCATCTT
CTTTGCTTCCACTCTCCCACTACTCTTCTGGGTCTGAGGATGGTTACACAATCACTGGCAGAGTGAAGATTCCACCAAGCAACGTG
GTTGGTCACACAGCAAAGTTCTCTAATGTCAAAGTTATACTCAATGGTGGACAGAGTGTTACATTTCTCAGGCCTGATGGATATTT
CACTTTTCACAAAGTGCCTGCTGGGACTCATTTGATCGAAGTATCTGCAATGGGCTACTTCTTTTCTCCGGTGCGAGTCGATGTTA
GTGCACGGCACCATGGCAAAGTTCATGCAACACTAACCGAAACCAGGAGGAGTCTTACTGAGCTGGTTTTAGAGCCATTGAGGGAA
GAGCAATACTACGAGATTCGAGAGCCTTTCTCCATGTTGTCAATGGTGAAGAGTCCGATGGGTCTCATGGTGGGATTCATGGTCGT
GGTTGTGTTCCTAATGCCCAAACTGATGGAAAACATAGATCCAGAGGAGATGAAGCAAGCACAAGAGGAAATGAGGAGGCAAGGTG
TGCCTTCGCTCTCGAGTTTGTTGCCAAGCGCCGGGGCTAGCCGTTAAGAGTTTCTCTGTCAGCTCAATGTATCACAAAATGAGCGG
AGAAAGGGTATCCCGTTCTTGTGAGAGACACACTCACTGTAATAGATTTGTATTGTGTAATAGATCTTCATATTTGTATTGTGTAA
TAGGTATTAAGAACATAAGAAAAAACGAGAATGTAATGCAATTTAAGAAGCATTAGAACAGCACGAACCAATAATTGGAGAGGTTC
ATCATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880672 predicted protein [Arabidopsis lyrata subsp. lyrata]8651e-090
NP_180103 uncharacterized protein [Arabidopsis thaliana]8587e-090
NP_194940 uncharacterized protein [Arabidopsis thaliana]7923e-082
XP_002867257 hypothetical protein ARALYDRAFT_913239 [Arabidopsis lyrata subsp. lyrata]7816e-081
XP_002285487 PREDICTED: hypothetical protein [Vitis vinifera]7063e-072

Swiss-Prot top hits (Blast detail)Scoree value
Q8VY97 UPF0480 protein At4g321307921e-083
Q0IHY5 UPF0480 protein C15orf24 homolog1962e-014
A5PJA8 UPF0480 protein C15orf24 homolog1882e-013
Q5TYV0 UPF0480 protein C15orf24 homolog1882e-013
Q4R5V2 UPF0480 protein C15orf24 homolog1882e-013

TrEMBL top hits (Blast detail)Scoree value
Q84JM6 Putative uncharacterized protein At2g253108585e-090
A9P9I9 Predicted protein7035e-072
B9RP12 Putative uncharacterized protein7026e-072
C6T319 Putative uncharacterized protein6991e-071
B9HAG9 Predicted protein6911e-070

Arabidopsis top hits (Blast detail)Scoree value
AT2G25310.1 carbohydrate binding8592e-092
AT4G32130.1 carbohydrate binding7921e-084

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  11%
 
93  33%
 
201  11%
 
192  22%
 
81  11%
 
121  11%

Unigene MembersMember information