Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17088

FASTA Sequence
Unigene ID: UN17088Length: 689  SNP
GAACACCCGTTTGTGTATGGTAAAGATCTCAGCGAGGCACGGTAGGAAAGGTCTCAAACAAAGAAAAAACGAATCAGAGTAACCAC
CCAAATAAATAATAAAAAGCAAAGCAAAACGAAGGTCAGAATCACGAAAACAAAACACAAAGGAAGCAAATCTGTTAAAAAAAAAA
GAAGAATCTCACTTAGCCATCATAACTTTGACGAACTCATCATAGTTGATCTGGCCATCACCATCGACGTCAGCCTCACGGACCAT
CTCATCAACTTCCTCGTCAGTGAGCTTCTCACCGAGGTTAGTCATGACGTGGCGGAGCTCAGCGGCGGAGATGAAACCGTTCTGGT
CCTTGTCGAAGACCCTGAAGGCTTCCTTGAGCTCTTCCTCGGAGTCAGTGTCTTTCATCTTGCGGGCCATGAGGTTCAAGAACTCG
GGGAAATCAATCGTTCCGTTGCCGTCGGCGTCAACCTCGTTGATCATGTCCTGGAGCTCGGCTTCTGTCGGGTTCTGACCAAGCGA
TCTCATGACAGTGCCCAGCTCCTTTGTCGTGATGCAGCCATCTCCGTCCTTGTCGAAAAGGCTGAAGGCTTCCTTAAACTCGGAGA
TCTGGTCATCGGTTAGCTGATCTGCCATTTTTCTTTCTTTTGTTGGTTGTTTGTTTCTTCTTCTTCGATTCCCTAATCGCGTGGTC
C

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
P93087 RecName: Full=Calmodulin; Short=CaM7625e-079
AAC49582 calmodulin TaCaM2-2 [Triticum aestivum]7609e-079
A2WNH1 RecName: Full=Calmodulin-3; Short=CaM-37591e-078
AAT73623 calmodulin cam-210 [Daucus carota]7591e-078
AEG75427 calmodulin [Aquilaria microcarpa]7591e-078

Swiss-Prot top hits (Blast detail)Scoree value
P93087 Calmodulin7623e-080
A2WNH1 Calmodulin-37596e-080
P62200 Calmodulin-1/11/167588e-080
P62199 Calmodulin-17588e-080
Q7DMN9 Calmodulin-5/6/7/87588e-080

TrEMBL top hits (Blast detail)Scoree value
B5AKW2 Calmodulin7624e-079
Q1PCH9 Calmodulin7624e-079
Q38M72 Calmodulin-like7624e-079
Q5QJ50 Calmodulin7624e-079
Q6L4B4 Calmodulin , putative7624e-079

Arabidopsis top hits (Blast detail)Scoree value
AT3G43810.1 CAM7 (CALMODULIN 7); calcium ion binding7595e-081
AT2G41110.1 CAM2 (CALMODULIN 2); calcium ion binding / protein binding7561e-080
AT2G27030.1 CAM5 (CALMODULIN 5); calcium ion binding7561e-080
AT3G56800.1 CAM3 (CALMODULIN 3); calcium ion binding7561e-080
AT2G27030.3 CAM5 (CALMODULIN 5); calcium ion binding7552e-080

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
115  16%
 
88  26%
 
76  19%
 
122  6%
 
105  16%
 
201  3%
 
64  13%

Unigene MembersMember information