Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17090

FASTA Sequence
Unigene ID: UN17090Length: 1690 SSR 
AGTCTTATAATTTCATAATGCAGACTTTATTCTTTATTTCTTCTTTGATTACTTGGCGAAATAAACACTCTAGAGTAGAAGTTATA
AAATACAAAAAAAAAAAAGCAAATCCCGAACTCGACAGACGTACTAGTACAGACAAACCTTAAAACCCCAAAAGAGATGATTGATA
AACGCTCCAAGACCAAACCAAACACAGAAAAAAAACTACGGATTGTCTGAACTCAGATTCGTACTCGCTTAGCATCAGTTTGTGGT
ACACTGATATCGCCACCATTGCCTTCCTTTGAACCATTTACAGTTTCATCCGGAACGACCGCATATCTCTCTGATGGTGACACCCA
GCTTTTCCCTGAAGATGGATCGAAATTAGAAGATTCTATCTGTTGTCCACTTGCACCATCCACGCTGAGTGCTTCTATAATCTTGG
GGGAATTCCTGTCAAGCGACTCTCCAATGCCGAGCTGTCCATTTGTACCTCTTCCCCAAGCAAACACATTGTTTCTTTCAGTCACA
GCCAAGGTATGTCTCCATCCACATGAGACTTGAACTACTTTCTGATCATCGGGAAACCGTACTTGCACAGGAGAACACTGATCAAT
ATTATCTCCCACTCCTACTTGCCCAAACTTATTCCAACCCCATCCATATAGTTTTCCATCAGAAGTCAATGCCATTGTATGTCTCC
AACCTCCCGAAATCTGGGAGATAACATTGTTGCCCAGCGCTTCCAGTTTGTGAGGAATAAGGTGATCCTCTAAGTCACCATGTCCT
AGCTGTCCATATTTGCTCCATCCATAAGTATATAATGCTCCAGAGTAAGAAACTGATATCGTGTGCCGCCATCCACAAGCAACCAT
CGACATCTTCTCAGCACCAGCAGAGGTAACCCTTTCAGGAACCAAGCGGTCATTCCGGTCACCTAATCCCAAATTTCCATATCTTC
CCCATCCCCATCCATAAAGATCACCATCTTCTGTAACCGCAGCAGTGTGTTCTGCACCAGCAGCAACCATTTTGATTCGTATTCCC
TCAAAGGCTTGAATCTTCCGAGGAACTAGAGAATCTTCAGTGTCCCCCAGACCAAGTTGACCATTCTGGTTGCGCCCCCAGCTCTG
CACCTCTCCTTCCATAGTCACAGCCAAACAATGACTATCCCCACAAGCAATCTGCTTTATCCGAACACCATGCAATGCTTTGATTG
GCAGCGGAGTAAACAAGTCGCTCGAGTTCCCATGGCCTAATCTCCCAAAATCACCCCATCCCCAACTGTAGACCTCGGAGCGTGAT
TGAGAATAAGCAACGGTGTGGTCAGCACCACAGGTAACGGAAACGATTTGGTGTTCATCCAAGGCGCTTAGCTGCGTGGGAGAAGG
TCGATCCTCCGCATCTCCGTGACCTAATTGTCCATCCTCTCCTCTACCCCATGAGCAAACAACATCCCCAGTGAGTAGAGCGACGG
AGTGACTAGCACCGGCGGATATGAGGAGGACCTTACGAGGCGGAGCTGTAACTGCTTCATCGGCCACCATCTCCTCTTCAGCCATC
GATCACAGTTCCTCTCTCTCTCTCTCTGAGTAGAAGATATTTATTTTGGTTTGGAAAAATCTGATTTCAAATTGCTTTATTTAAAA
AAAGAAAAAAACTTCTATTTTTGTGATAAATTAGGAAATTTTGCAGCTTCTCTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33982 unnamed protein product [Thellungiella halophila]22131e-246
XP_002866579 UVB-resistance 8 [Arabidopsis lyrata subsp. lyrata]22013e-245
NP_201191 protein UV-B resistance 8 [Arabidopsis thaliana]21942e-244
AAD43920 UVB-resistance protein UVR8 [Arabidopsis thaliana]21871e-243
XP_002274569 PREDICTED: hypothetical protein [Vitis vinifera]19414e-215

Swiss-Prot top hits (Blast detail)Scoree value
Q6PAV2 Probable E3 ubiquitin-protein ligase HERC45486e-055
Q5PQN1 Probable E3 ubiquitin-protein ligase HERC45461e-054
Q5GLZ8 Probable E3 ubiquitin-protein ligase HERC45414e-054
Q15751 Probable E3 ubiquitin-protein ligase HERC15218e-052
Q15034 Probable E3 ubiquitin-protein ligase HERC35172e-051

TrEMBL top hits (Blast detail)Scoree value
Q9FN03 AT5g63860/MGI19_621941e-244
Q9XHD7 UVB-resistance protein UVR821879e-244
B9HF48 Predicted protein19021e-210
B9SAB0 Uvb-resistance protein uvr8, putative18624e-206
C6TC00 Putative uncharacterized protein18169e-201

Arabidopsis top hits (Blast detail)Scoree value
AT5G63860.1 UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor21956e-247
AT5G60870.1 regulator of chromosome condensation (RCC1) family protein4293e-042
AT5G60870.2 regulator of chromosome condensation (RCC1) family protein4033e-039
AT1G27060.1 regulator of chromosome condensation (RCC1) family protein3594e-034
AT3G53830.1 regulator of chromosome condensation (RCC1) family protein / UVB-resistance protein-related3532e-033

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
78  50%
 
103  19%
 
82  13%
 
121  6%
 
111  6%
 
211  6%

Unigene MembersMember information