Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17103

FASTA Sequence
Unigene ID: UN17103Length: 1391  SNP
CCACAAATAACTATTCTTATTATTTTCTTCCTTTTTTAAACGACAACATTTCTTCAGCCTTCTCATACAAGAAAATAGATATAAGC
AAGACATTTCTGTTTTATATATAATAACTCTATGCCATAACAACTCACTCGGTATATAAATCATCTCATTTAAAAAGCACCAGAGA
TAAAAATTACTTTTTAGAAAAAGCCCACACTCCTTATACGAAAAAACCTTTAAAATAAAACAAGGACCATTTTAAGCCTTGCGAAC
GCTGAGGAGCTTAACATCGTCGATCACGGGGCCACACAGAGACGAGAAATCATCGCTTCTCATCGCGTAAAACGTGCTGTAAAACA
TAACCCTCGTGCGGGTAGAAACCGCCACAAACCGCAAAGAAGCGCGTTTGAAGCCTCCCTTTCCTTTCGACTCGTAAGGAACCTTT
AACGTGTCCCTTCCCGCAAACGCCTCGACTATCATCGAGCCTTCGCACGCGTTGTTAGCATCTCCAACCGCAAAAGAAAGCACGTA
AGTCTTCCCTATGATGGTCCTAGCCACCTGAGCGATCGCGCTTTCTTTCCCCGCAACTAGCTCGACGGCACGACGGCCTTGTGGGA
CTGAGAAGTGTTCGACGTCAACGTATTTGACGGCTTTGAGGGATTCGACCATCCAAGCGGGTAAAGGAGAGTGATCATCTTCTATG
AAGGGAGGAATCAAAACGCCGGTTGTGGAGTTTGGGAGTAGATAGGGACCTTCTTCGAATCCTCCGTTTTTCAATATGTTCTTATT
GGTAGGTCTTGGAGGGTACAGGGCCTTGATTGCAACACCATCAATAAGTGGTCCACAAGCAGGATCTTCTTCCTCGCCAGGATTAT
GAATCACGATCTCTGCCACATTACTCTCGGCTTGAAACGCCCAAGCGTATAGGTCCCATCCACTGCTACTGTACACAGTCTGTATA
GGAATGATGCCCGAGTCAGGTGCCACCGATATGTTGAGCCGTTCGTCTTGAGCACAAGTCCTTGCGGCACTGAACGTGAGCGAGTA
ATACATTCCTTTTGTCACGTTAAGTCTCTGTTTGATCGATGCTTCGTTTCCTAGCCGGATGGCGAATTTTCCGGCGGGGACTACTA
GGAGCATGTCTCCTTGTTTCTGACCGGATTTTATGTATTCGACGAAGCCTGTAAGCTCCCAGCTTGGAATAGCGTTCTTGTTTAGC
ACTTGTGTTCCTTTCATGTCCGATGGTTTTGGTCCTAGCTCAAAATCACCGTTTGGTAACATCCCGTCACGGAAGCAGACGACGGA
GGTGACGGTGGAGATGAGAAGAACGCAGAGAAACGAGCCGGTGCCTCCTTTCATTGCTAACAGCCTAAGTAGAAGAGATGGAAACA
GAGTTTAATAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002871473 hypothetical protein ARALYDRAFT_487977 [Arabidopsis lyrata subsp. lyrata]18142e-200
NP_196703 uncharacterized protein [Arabidopsis thaliana]18123e-200
AAN31807 unknown protein [Arabidopsis thaliana]18097e-200
AAM63507 unknown [Arabidopsis thaliana]18071e-199
NP_197928 uncharacterized protein [Arabidopsis thaliana]16806e-185

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9LYE7 Putative uncharacterized protein At5g1142018122e-200
Q8H168 Putative uncharacterized protein At5g1142018095e-200
Q8LCM9 Putative uncharacterized protein18078e-200
Q94F20 At5g2546016804e-185
Q8LEX7 Putative uncharacterized protein16752e-184

Arabidopsis top hits (Blast detail)Scoree value
AT5G11420.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25460.1); Has 185 Blast hits to 157 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).18121e-202
AT5G25460.1 unknown protein16802e-187
AT4G32460.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).15306e-170
AT4G32460.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).15306e-170
AT1G80240.1 unknown protein12295e-135

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
93  8%
 
1112  33%
 
61  3%
 
75  14%
 
126  17%
 
87  19%
 
102  6%

Unigene MembersMember information