Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17128

FASTA Sequence
Unigene ID: UN17128Length: 1390  SNP
AGACCAATTTCGACTTTCTCCATGTGTGTATATTGTACACGGAAATAACTTTTAGACAAGGCAGACACGACCACATGTCCAGACCA
CACGGATATGAGTTTACCGTTCAAGTCTTATCTTCTTAGATCAATTATATTTTTCTAAAATAAACAACGGAGCCAAGAAATGAACA
TTAATGACGTTAAGGGATCTCATGCATCCACATTAATTTCTCACGTCTCTTATTCAATCTCCTATATCATAGATAGAAACCAATTC
ACTGAAGATCACTTATACGACAATTTTATTGTTTATCTTAAACTTAGAGAGGCTTCTGGCAAGTGATGATGCCAAACTTAATGACA
CCTTTCTTGTACCCTTCGATCATCAATGGCATTGTCAATGCTCCTTTTATACTCTTCATACCACTACGAAGCAGAAACACAAGGCC
CTTCCATGTTAATGCGGTTCGTATAACCGCCGGCCAGAAAGGAGCTACATTCTCTGACCAATCTGCACACTTAATATCCTGGAGCG
AGAGGGATTGAAGCAAATCGACATAATCAGAGGTGGAGCACCAGGCCGGGAGATAAAATGTTTTGCAGATTCTGTCCAAGAGGTTC
TGTTCCCATGGCTGCAAAGCTTCTTCCCCTGGGGATAGATTTCTGTGGCACCATGTCACTATTATTATCCTTCCTCCTGGAGCCGC
CACACGTACCAATTCCTTCACGAACTTGGCCTTGTCAGGCATATGCTCACCGCTTTCCATTGACCACACAAGATCGAACATACCAT
CTTCAAATGGTTGCTCCAGTGCATCTGCAACCTGGAAGGAAACCTTATGAGAGAGTGATTGAGCGGCGGCGAGATCATTGGCTCTC
TTGGCTTGAACAGGACTGAGTGTGATGCCAACGCATTCGGCACCAAATTTAGAGGCAATATATCTTGAGCTTCCTCCGATCCCACA
ACCAACATCCACTACTCTCTTTATCTTTTTCTCCTCTTCAGTAACGCCAGCGAAACGTAGAGACTCTTCAATCATCCGGATCTGAG
CTTCCCGGTGACCGGAATCTGAAAGTTGAACAGAGGAATCAGGATCGTAGAAGCCGTGATGCATATGATCTCCCCAAATCTCCTCC
CATAATCCCGACGTCTCGTTGTAGAATTCAGCTATTCCTTCTCGCAGCGCCTCGACGGAGGAGGTGGCAGCAGCCGTCACAGCCAC
GCTTCCACGTGATGCCGTCTTCATCGTCGTCATTAAGGCTGAGGATGGCCGTTGGGACTGAATGAGAAGCGACGGTGAACGGAGAG
AAGAAACTTTGTGCCTGGGGAGGCTGATGAGAGAGGAGGGTGCGAGAGTCGCTTTCATTTATAATGAGAGGTTGGCGAAACAGGAA
ATGTGGCTGTGTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACD03285 gamma-tocopherol methyltransferase [Brassica napus]17532e-193
ACD03286 gamma-tocopherol methyltransferase [Brassica napus]17399e-192
ACD03288 gamma-tocopherol methyltransferase [Brassica napus]17201e-189
AAO13806 gamma-tocopherol methyltransferase [Brassica oleracea]17121e-188
ABF56215 gamma-tocopherol methyltransferase [Brassica napus]16977e-187

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZSK1 Tocopherol O-methyltransferase, chloroplastic15423e-170
O82427 24-methylenesterol C-methyltransferase 22116e-016
O14321 Sterol 24-C-methyltransferase1892e-013
Q9FR44 Phosphoethanolamine N-methyltransferase 11892e-013
Q9C6B9 Putative phosphoethanolamine N-methyltransferase 31848e-013

TrEMBL top hits (Blast detail)Scoree value
B2ZC77 Gamma-tocopherol methyltransferase17531e-193
B2ZC78 Gamma-tocopherol methyltransferase17396e-192
B2ZC80 Gamma-tocopherol methyltransferase17201e-189
Q8GZS9 Gamma-tocopherol methyltransferase17128e-189
Q1HBJ5 Gamma-tocopherol methyltransferase16975e-187

Arabidopsis top hits (Blast detail)Scoree value
AT1G64970.1 G-TMT (GAMMA-TOCOPHEROL METHYLTRANSFERASE); tocopherol O-methyltransferase15432e-171
AT3G18000.1 XPL1 (XIPOTL 1); methyltransferase/ phosphoethanolamine N-methyltransferase1892e-014
AT1G73600.2 methyltransferase/ phosphoethanolamine N-methyltransferase1847e-014
AT1G73600.1 methyltransferase/ phosphoethanolamine N-methyltransferase1847e-014
AT1G48600.2 phosphoethanolamine N-methyltransferase 2, putative (NMT2)1821e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
85  21%
 
77  29%
 
64  17%
 
124  17%
 
101  4%
 
113  13%

Unigene MembersMember information