Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17136

FASTA Sequence
Unigene ID: UN17136Length: 1007  SNP
GAAAAGAGAGAGATATTAATCTTGATGAACTTGGTTCCTTTGTACACTGAAGATTTTTAAATTAGTTCATGGAGCTACAGCAATAC
CATATTGTTTCATGCTCACAAACCAAGAACTCTAAGATGCAAAACACACAGAGATATTAAGGTAGCATAAGATAGAGATGTATTAA
ATTCATAGGTCCGTCTTAAATCATCCGCTGAAGGTTTGGACAATAGTGTTGTGCCATGGGTCAGACAAGTGCTGCAACAGGTTCTC
AAATGGTCCCTTTCCAGTCACATTGTGTTGAATCACGAACCCTAAGAATGCCAACATCGCCAACCTCCCATTTGCAAGCTCTTTCT
CCTTAGCCTCGAGCGTAGGAGCGAAGTTAAGAGGGTTAAAGATTCCTCCGGGGTAACCAACTTCATTTGGAGGCAAGCTGTATTGC
TTGAAGATAGGGTCTTGGTTCACACTCCCTGGGTTCTTAATGTCCTGCCACCGTCTGATCTCAACGTAATGAAACAATATGAACTC
GATCACGAACAATGTCGATGATGATGCAAAATACTGCTCTTTCCCGGCATCGTACCACTCAGGAACGTTGATGATTCCGATCTTGG
TGAAAACTTCAGGCAAAAGCATCCCTGCGACGCCGAGCATGGCCCACCGTCCGTTGACAAGCTCTGCCTGGATGAACCACTTCAAG
TTCTCTGGATCCTCTGCCAGTCCCAATGGGTCAAACCCATTATCACCGGCAAGACTGCCGTTGAGATAACCAGGAGATGCCAAACC
GGGCAACCATTCTCCTTTCTTAGCTTCAACCTTGAACGAGGACGTCTTTGAGCCGATTGACTTAAACGACAATTCTCGGTTCAACC
TACCGGAAGAACCGGTGAGGAATCTTGGCTTTGAAGTGCATGGTCTGAATATCGAGGCCGAGGCTTGAGTAGTGACAGTGGCCATT
TCCCCTACAGAGCTTGGATACAGGAAGGTAGAGAATGGATTGGAATCAAGAAGAGATTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33651 unnamed protein product [Thellungiella halophila]12915e-140
NP_190331 chlorophyll a-b binding protein 4 [Arabidopsis thaliana]12522e-135
XP_002877563 chlorophyll a/b-binding protein [Arabidopsis lyrata subsp. lyrata]12361e-133
XP_002514741 chlorophyll A/B binding protein, putative [Ricinus communis]12262e-132
ACJ85068 unknown [Medicago truncatula]11983e-129

Swiss-Prot top hits (Blast detail)Scoree value
P27521 Chlorophyll a-b binding protein 4, chloroplastic12527e-137
Q9SQL2 Chlorophyll a-b binding protein P4, chloroplastic11603e-126
Q36718 Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment)8225e-087
P13869 Chlorophyll a-b binding protein, chloroplastic5887e-060
P10708 Chlorophyll a-b binding protein 7, chloroplastic5842e-059

TrEMBL top hits (Blast detail)Scoree value
B9RLX2 Chlorophyll A/B binding protein, putative12261e-132
B7FJY9 Putative uncharacterized protein11982e-129
B9N4C4 Light-harvesting complex I protein Lhca411902e-128
A9PIX4 Putative uncharacterized protein11874e-128
Q7M1K8 Chlorophyll a/b-binding protein (cab-12)11767e-127

Arabidopsis top hits (Blast detail)Scoree value
AT3G47470.1 LHCA4 (LIGHT-HARVESTING CHLOROPHYLL-PROTEIN COMPLEX I SUBUNIT A4); chlorophyll binding12526e-138
AT3G61470.1 LHCA2; chlorophyll binding6049e-063
AT1G45474.1 LHCA5; pigment binding5341e-054
AT1G45474.2 LHCA5; pigment binding5341e-054
AT1G19150.1 LHCA6; chlorophyll binding5303e-054

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1012  22%
 
64  7%
 
88  15%
 
1916  29%
 
710  18%
 
92  4%
 
182  4%
 
151  2%

Unigene MembersMember information