Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17149

FASTA Sequence
Unigene ID: UN17149Length: 2017 SSR 
GGACCACTCCTTTCATATAACCCACTAATCAATTACCTCCTACTCCTCTCTCTCTCTCTTTCAACAACCAAGAAGCGAGACACAGA
GGAGAGAGACTTCTTTGTTTTGCCTCTCTGGCTTATATATTCAGACACTGTCTTAACATAAACAAAACAACACAACACAAAATTTG
TGTTCTTTTGACTCTTCTTTCCTCCTTTTAAGACATCAATGGCTGGGACTGGAATTTTCACAGAGATTCTAGACGGAGAAGTCTAC
AAGTACTACTCTGATGGAGAGTGGAAAACTTCTTCCTCCGGTAAGAGTGTGGCCATCGTTAACCCAGCCACGAGGAAGACACAGTA
CAAGGTTCAAGCATGCACGCAAGAAGAAGTGAACAAGGTGATGGAGATGGCTAAATCTGCTCAGAAGTCATGGGCAAAGACTCCTC
TTTGGAAAAGAGCTGAGCTTCTTCACAAAGCTGCTGCGATCCTCAAGGACAACAAAGCTCCCATCGCTGAGTCTCTTGTCAAGGAA
ATTGCTAAACCAGCCAAAGATTCTGTCACTGAGGTTGTGAGGTCTGGAGATTTGATCTCTTACTGTGCTGAAGAAGGTGTTAGGAT
CTTAGGTGAAGGGAAGTTCCTGCTCTCTGATAGTTTCCCCGGTAATGAACGTACCAAGTACTGCCTCACTTCCAAGATCCCACTCG
GTGTGGTTTTGGCTATTCCTCCATTCAACTACCCTGTCAATCTCGCTGTATCAAAGATCGCTCCTGCTTTGATAGCTGGAAACTCC
CTTGTCCTGAAACCTCCAACTCAAGGAGCTGTTTCTTGCCTTCATATGGTGCATTGCTTTCACTTAGCTGGTTTCCCAAAAGGTCT
CATTAGCTGCATCACTGGAAAAGGCTCTGAGATTGGCGATTTCCTCACCATGCACCCTTCTGTTAACTGCATTAGTTTCACTGGCG
GTGATACCGGAATCTCAATCTCCAAGAAAGCTGGCATGATCCCTCTCCAGATGGAACTTGGAGGAAAAGATGCATGCATTGTCCTG
GAAGATGCTGATCTTGATTTAGTGGCTTCCAATATCATCAAAGGAGGATTCTCCTACAGTGGGCAGAGATGCACTGCGGTTAAGGT
AGTCCTAGTGATGGAATCAGTGGCGGATGAGCTTGTTGAGAAAGTGAAAGCTAAAGTGGCGAAACTCACGGTGGGACCGCCTGAAG
AGAACTGTGATATTACAGCCGTGGTGTCGGAATCCTCAGCTAATTTCATTGAAGGATTGGTGATGGATGCTAAGGAGAAAGGAGCA
ACGTTCTGTCAAGAGTATAAAAGAGAAGGTAACTTGATTTGGCCGTTGCTTTTGGACAATGTCAGACCGGACATGAGGATTGCTTG
GGAGGAACCTTTCGGTCCTGTCTTGCCTGTCTTGAGGATCAGTTCGGTTGAGGAAGGCATTAATCATTGCAATGCTAGTAACTTTG
GCCTTCAGGGATGTGTATTCACTAAAGACATCAATAAGGCAATGCTGATCAGTGATGCAATGGAGACAGGAACGGTTCAGATCAAC
TTTGCGCCAGCTCGTGGACCAGACCATTTCCCTTTCCAGGGACTAAAGGACAGTGGAATAGGATCACAAGGTGTGACAAATAGCAT
CAATTTGATGACCAAAGTGAAGACCACTGTCATTAACTTGCCTACGCCCTCATACTCTATGGGTTAGTTTCCCTGTTTGTGTTCTT
CATCTTTCACTCGCTCGTTACTATCTCGTTTGTATCGGATTGAATCAAAAACTATGAATAAAATGGAGTGATTAGCGTAACTGTTA
TGGTTTGTAATAACTATGTAATCAGTAAGAGATATTAATTAGTAGTAACATATATGTTGTACTGCAAAAGAACTGAGAAAGTGAGT
GAGAGATTGATTGTGTTATGTTATCGGTCACAGGAGACGGTTTCATCTCACGTCTGTGATTGAAGCACAAAGATCCTTTTGATGAG
AGTATTTGGAGTTTATAACTTTAAGCTTTTTCATACTAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34194 unnamed protein product [Thellungiella halophila]25349e-284
NP_180004 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase [Arabidopsis thaliana]24991e-279
NP_001189590 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase [Arabidopsis thaliana]24991e-279
XP_002880570 ALDH11A3 [Arabidopsis lyrata subsp. lyrata]24981e-279
ABB83822 non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase [Arabidopsis thaliana]24873e-278

Swiss-Prot top hits (Blast detail)Scoree value
Q1WIQ6 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase24994e-281
P93338 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase23803e-267
P81406 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase23606e-265
Q9SNX8 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase23534e-264
Q8LK61 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase23203e-260

TrEMBL top hits (Blast detail)Scoree value
B9DHD2 AT2G24270 protein24997e-280
A9PEY4 Predicted protein24092e-269
A9PGH7 Putative uncharacterized protein24073e-269
B9HAS0 Predicted protein24012e-268
A5BHS5 Putative uncharacterized protein23662e-264

Arabidopsis top hits (Blast detail)Scoree value
AT2G24270.2 ALDH11A3; 3-chloroallyl aldehyde dehydrogenase/ glyceraldehyde-3-phosphate dehydrogenase (NADP+)25003e-282
AT2G24270.1 ALDH11A3; 3-chloroallyl aldehyde dehydrogenase/ glyceraldehyde-3-phosphate dehydrogenase (NADP+)25003e-282
AT1G74920.1 ALDH10A8; 3-chloroallyl aldehyde dehydrogenase/ oxidoreductase5952e-061
AT3G48170.1 ALDH10A9; 3-chloroallyl aldehyde dehydrogenase/ oxidoreductase5504e-056
AT1G79440.1 ALDH5F1; 3-chloroallyl aldehyde dehydrogenase/ NAD or NADH binding / succinate-semialdehyde dehydrogenase5406e-055

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
77  33%
 
123  14%
 
84  19%
 
93  14%
 
111  5%
 
102  10%
 
181  5%

Unigene MembersMember information