Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17160

FASTA Sequence
Unigene ID: UN17160Length: 601  SNP
GGACTGTCGTCTCCGTCAACCTCTCTATCTTTCGTCTCCATAGCCTACCTGCCGATTGTTACCCGTCTCCGTCGATAACACCATGG
CGCCAAAGAAGGATAAGGTTCCACCGCCGTCGTCAAAGCCGGCTAAATCCGGAGGTGGAAAACAGAAGAAGAAGAAGTGGAGCAAG
GGAAAGCAAAAGGAGAAGGTGAACAACATGGTGTTGTTTGATCAGGCTACTTACGACAAGCTTCTCACTGAGGCTCCCAAGTTCAA
GCTCATCACCCCTTCCATTCTCTCCGACCGTATGAGGATCAACGGGTCTCTTGCAAGGAAGGCAATAAGGGAGCTAATGGCTAAAG
GTGTGATCAGGATGGTCGCTGCTCACTCGAGCCAGCAGATCTACACTCGTGCCACCAACACCTAAACAAAACAGATCGACCTTTGT
CAATGTTTTGGTTCTCCAGTCTTAATCTCTTTTGATGTATACGTTACTCATCAGAGCTCTTAATAGTTCTTTTATGTTTGAACTCC
TTCGTACTCGAGAAACTCTTTAGAAGGCTGTTTTGAGATATTATGTCTACTTAATATTCCGGAATTGATTTTTATATTTGTTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195631 40S ribosomal protein S25-4 [Arabidopsis thaliana]5431e-053
NP_179752 40S ribosomal protein S25-2 [Arabidopsis thaliana]5331e-052
NP_567968 40S ribosomal protein S25-3 [Arabidopsis thaliana]5196e-051
XP_002512926 40S ribosomal protein S25-1, putative [Ricinus communis]5161e-050
ABK21138 unknown [Picea sitchensis]5133e-050

Swiss-Prot top hits (Blast detail)Scoree value
Q9T029 40S ribosomal protein S25-45435e-055
Q9SIK2 40S ribosomal protein S25-25337e-054
Q8GYL5 40S ribosomal protein S25-35193e-052
P46301 40S ribosomal protein S254899e-049
Q9SIW5 40S ribosomal protein S25-14772e-047

TrEMBL top hits (Blast detail)Scoree value
B9RH67 40S ribosomal protein S25-1, putative5169e-051
A9NKH7 Putative uncharacterized protein5132e-050
C6SWX1 Putative uncharacterized protein5132e-050
C6SW17 Putative uncharacterized protein5123e-050
C6TBE7 Putative uncharacterized protein5113e-050

Arabidopsis top hits (Blast detail)Scoree value
AT4G39200.1 40S ribosomal protein S25 (RPS25E)5444e-056
AT2G21580.1 40S ribosomal protein S25 (RPS25B)5345e-055
AT4G39200.2 40S ribosomal protein S25 (RPS25E)5273e-054
AT4G34555.1 40S ribosomal protein S25, putative5193e-053
AT2G21580.2 40S ribosomal protein S25 (RPS25B)5175e-053

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
74  15%
 
82  8%
 
98  31%
 
122  8%
 
103  12%
 
112  8%
 
63  12%
 
182  8%

Unigene MembersMember information