Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17163

FASTA Sequence
Unigene ID: UN17163Length: 716  SNP
AGGCGAAGTTAATGAAGATTTTTTAAAATTTTCATATTAAGGAAGTGGCAAACCCAAAGTACATAAGATGGTAGTCTCTTAGTATC
ATACCAATGCGAATATAAAAAAAAACAGTAACAAGTGATCAAAGATGAAAGTTGAAGAAATGTTTTGGAACAGGGAGGATAACAGT
GATGATCCACTAGAGCAGAATGTAGCAAACGGCTTTAGGGGAAATGTAACACAAGCAGCTCAGAAACCATGGATCTTGATGTTGTC
CTTCTTCACAAGGCCAGCCTGGACTAGGAACGTGGATACGTTCTTCCTCTGGTCGCCTTGAAGCTGAATAACCTGTCCGAGTTCAG
AGTCTTGAACCACAGTTCCGTTGCAACAAAACTCCTTCTTGAGGTCCTTAAGTATCTTGCTGTAACTATACTCTTTCTTCAGCCCC
TGGACTGTTGTCAAGCTTTTTCTACCATTCCGCTGCTGGACACGTATGTGGACGTACTCCTTTGTTCCCGCACCTGAGTCCTCAGC
ATCAACATCAGCAAACGGGTCGAAGGCAGTAGGGACCTGGGAATCAAGTTCAGACATGAAACTTTGTTGATCTGATGGGCAAACGA
CAGAGAAACTGAGACCTGATTCGAGGAGTAGCGTTTCGAGGATCTGATTTATCGGGAGAAGAGAAGAATGAAACCCTAGATTCGGA
TAAAGTATGCAACTTCTGTTTCGGTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002867520 hypothetical protein ARALYDRAFT_492082 [Arabidopsis lyrata subsp. lyrata]5691e-056
NP_194443 protein translation factor SUI1-1 [Arabidopsis thaliana]5663e-056
NP_200287 Translation initiation factor SUI1 family protein [Arabidopsis thaliana]5629e-056
Q9SQF4 RecName: Full=Protein translation factor SUI1 homolog; AltName: Full=Translation initiation factor nps455573e-055
NP_175831 protein translation factor SUI1-2 [Arabidopsis thaliana]5565e-055

Swiss-Prot top hits (Blast detail)Scoree value
P41568 Protein translation factor SUI1 homolog 15661e-057
Q9SQF4 Protein translation factor SUI1 homolog5572e-056
Q94JV4 Protein translation factor SUI1 homolog 25562e-056
O48650 Protein translation factor SUI1 homolog5266e-053
P56330 Protein translation factor SUI1 homolog5015e-050

TrEMBL top hits (Blast detail)Scoree value
Q9FFV1 At5g547605626e-056
B9SA38 Translation factor sui1, putative5412e-053
A9XNY8 Putative translation factor (Fragment)5384e-053
A9XNZ0 Putative translation factor (Fragment)5384e-053
A9XNZ1 Putative translation factor (Fragment)5384e-053

Arabidopsis top hits (Blast detail)Scoree value
AT4G27130.1 eukaryotic translation initiation factor SUI1, putative5671e-058
AT5G54760.1 eukaryotic translation initiation factor SUI1, putative5633e-058
AT5G54760.2 eukaryotic translation initiation factor SUI1, putative5633e-058
AT1G54290.1 eukaryotic translation initiation factor SUI1, putative5572e-057
AT5G54940.1 eukaryotic translation initiation factor SUI1, putative4381e-043

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
116  18%
 
127  21%
 
65  15%
 
182  6%
 
201  3%
 
99  26%
 
84  12%

Unigene MembersMember information