Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17166

FASTA Sequence
Unigene ID: UN17166Length: 1604  SNP
AATTGAGTCTCAATGGGTTGCTCAAGAGTGGATCTATTGTTGGTCCATAGAAAGAACGTACAGATGAGAGAGTATCAGAAAGTCAG
GAATTTATCAAAGTCTAAAAGAAGCTGCCACGCCCATCATTTCACCATATTCTTTTTTTTGGTAGCTAAAAAAGTTCTAACATCCC
CAACAAACTAGCGCTAAAATAATTCTTTAAAAGAAAGAAAAACAAATACGACTCTGAAAACTTGTTGGATCCTTCATAATCTCCAC
CTTCTTCGGCTTAGAGCTCGTCATGGGCGGCATCATCCTTGTCTGAGGAGGCTTCTTCCTTGGTTTCCTCAGTTTTTGATTCAGTG
TCGGATTCATCTCCTTCATGGTCATCGTCCTCTTGTTCATCCTCAGCATCAGAATCAGCAGCGGGAGCATCCTTTGATTCCTCTTC
CTCTCTCTTCTTCTCAGCTTCGTCGAATGCTGCTTTCTCAGCATCCTTGAGCTTTCCCCAGGTTTCCTCAGCCAACTTCTTAGCGT
ACTCAGGGTCATCGCAGACTAAGACATTGTCGAACAATGATCCAGATTTCACCTGCCACAACTCTACTCCAACATACTTAAATTTG
AAGACATAGAGTTCTGGGTCATCCTTGAAGTCAGGGTTGTCAATCATTGGAGCCTTCCATTTGCCCTTGTAGTTAGGGTTCTTGAT
TTTCTTGGGCTTCCATTCACCGTTGTACTCGGGGTTGGGAATGGTAGGGGCAGTCCACTCACCATCTTCTTCATCATCCCAGTCCT
CAGGCTTCTTTGCATCAGCGTCTGGGATCTCCTTTGGGATGTCATCGTATCCAGCTGGCTTTGTGTCTTCAGGATCAGGAATGTAC
TCTTTGTCATCCCAGTCCTCAGGCTTCTTGGCGCTTGGATCCTTAATCTTCTTGGCTGGGAGGAGATCCCAGTCAGAGTAGAGGCT
ACCAGTTTGCTTCTCAACGTTATCGATAAGAATACTGTAAGTAGCATCTGGGCGGAGGATAAACGTGTAGACATGTGTGAGCTGAT
CAGTCTCACATGGAACCTCCTTCTTGATCAGATGGTTTTTTCCATTGTAGGTAAGGATAGCATGCACTTTCTTGGTGTCGTAGCCA
CAGATATCAGGACCAAACATGATGCTGTAAGGAGTGTCTCCACCGAATTTCTTCTGGTCAACATCACCACTGAGAAGCTTCATGTA
TCCACCACCACAGTCCAGCTTCTGCTCGTGCTTGACAGAGAATTGGAACACAAGGGTCTTGTCCTTGTTGCTGAACTCAGGGAACT
CAGCTGAAATGGCGTAGAATCTGTAGTCCTCGCTAGTCTGGATACCTTTGTCGTTAGCGTCACCAGACCAGTTGCCAGCTGTGTGG
CTCCATTCCCCAGCAGTGTTGTCATCTTTCTTCCAGTCAGATTTCACCCATCTGTTCTCCCATCCATCGTCGAATTTCTCCTCGAA
GATAACGCTAGCAGATGCGATCGCGACGAGGCCGATAAGGATCAGAGAGATGAAGTTAGGGTTTAGTTTCGCCATCGCTAGAAACT
CAGATCGCACCTTCCTCGAAAACAGTAAGATGCTACAAAAGCCTATAAGAAGATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_176030 calreticulin-1 [Arabidopsis thaliana]20893e-232
AAN60341 unknown [Arabidopsis thaliana]20454e-227
AAM63796 putative calcium-binding protein, calreticulin [Arabidopsis thaliana]20428e-227
NP_172392 calreticulin-2 [Arabidopsis thaliana]20401e-226
XP_002892492 calreticulin 2 [Arabidopsis lyrata subsp. lyrata]20401e-226

Swiss-Prot top hits (Blast detail)Scoree value
O04151 Calreticulin-120891e-233
Q38858 Calreticulin-220406e-228
P93508 Calreticulin18766e-209
Q40401 Calreticulin18498e-206
Q9XF98 Calreticulin18443e-205

TrEMBL top hits (Blast detail)Scoree value
Q8H792 Putative uncharacterized protein (Fragment)20452e-227
Q8LC80 Putative calcium-binding protein, calreticulin20425e-227
C0Z2C0 AT1G56340 protein19565e-217
C4PB36 Calreticulin19314e-214
A0A762 Calreticulin-118948e-210

Arabidopsis top hits (Blast detail)Scoree value
AT1G56340.1 CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding20908e-235
AT1G09210.1 calreticulin 2 (CRT2)20414e-229
AT1G56340.2 CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding19285e-216
AT1G08450.1 CRT3 (CALRETICULIN 3); calcium ion binding / unfolded protein binding13202e-145
AT1G08450.2 CRT3 (CALRETICULIN 3); calcium ion binding / unfolded protein binding7287e-077

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  4%
 
93  6%
 
87  15%
 
109  19%
 
717  36%
 
62  4%
 
115  11%
 
201  2%
 
191  2%

Unigene MembersMember information