Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17170

FASTA Sequence
Unigene ID: UN17170Length: 1799 SSRSNP
GGTCGTTGTGCGCCGCCTCGAGCTCTGTCTGTCTCGCTCATTTTCACAGAAGAGTTTTTTCTCAGGAAAAACAATGGCGGGTTGGC
AGAGGAATCTACAGTTAATTCGTCAAGTTGCGAGAAGAGTGACGAACAGTAACGCTTCGAGAGCCAATTACTCTTCAGCTCGTAGT
TTGGAATCCCCTTTCTCAAAAGGTTACTTGCAGGGTTTGTTGAGACCAACCTACACCTCAACACCACTGCATCATTATCTACAGCA
AGTGGGGATTTCGACGTCAAGAAAACTCAAGGCTGGTGAAGAGCCTGTTTCATCACCTTTGTCATCTCCAGCTCTGTTGGGTACTG
GAAAAGAAGAAGAAGAAGAGCAGAAGATTATCCCTAAGCGTAAGAAAGTGCAGGCTGTACTCAAGGCCATTAAGCAGAGTCCTAAG
AAGGTCAACCTAGTTGCAGCGCTAGTACGTGGTATGCGCGTTGAAGATGCTCTGATGCAACTGCAAGTCACTGTTAAACGGGCTTC
CCATACCGTGTACCGGGTTATCCACGCCGCCCGAGCTAATGCTTCTCATAACCATGGACTAGATCCTGACCGTCTCATCATTGCGG
AAGCGTTTGTTGGGAAGGGACTGTTCAAGAAACGGATATCTATCCATGGAAAAGGAAAATCCGGGGTGATGATAAGACCCGAGTGT
CGTCTAACTGTCGTAGTTAGAGAGACGACTCCAGAGGAAGAAGCTGAGATTGCCAAGCTCAAGGTTCACAACTGCAAGAAGAAGCT
AAGCAAGCGGGAGAGGAGGCTTGTCCCCTTCAAGCTCATTGAGACAACTTCAATCTGGAACCGTAGAGGCACTAAAGCCAATCATC
GTTCCTCAGAGTTGGTACCATCTCAATCTCGCTAGTGTCTTCGTTCCCCGATGGTTTACAAGAACGGTTCACTAGTACACCTTCTT
GTTTGTTTTTGGTTTGACATTGTACCGGTACTTAATTGGATCGGTTTATTATTTGCATTAAATAAAATGTTGCAAGAACGGATTAA
GGTACAATGACTTAGTAGACGTTACTTACAAATCCGAATTTTAGAGAAATGAAACTTACATCAAACAAACACAAACGATGCAAAAC
TTAGGAATGGGACAGAGACGTGTGTCTGAAAGCCCTGAGAATCTCTAGGACTTGTTCATAAGGAGGACTTAGATCTTTGACCACAT
CGGTTACGTTAATAGCATTGAGCCAACCATAGACACGAGGAACTGTCTCTGGGTCGACGATCTTCACACCCAAAACTTCTTCGTGT
GCCTTGTAAGGGCTAAGCAAAGTGCACATCACAATGTCAACGAGGCTCATGGTCTCGTTTGTCACGGTAGGTTTACCATCAGTATC
CGAGAAAATCTCCTTGAGGCCTTCTTTCTCTATGATGCTCAGCTTCTCCTTCACTTCTACGAGAGCTCTCTCTTGCTCTTCTCCTT
CGGTTTTCACCACTTTCATCACCGCATCGAAAAGATGTAACTGGATGTAGCTGGCCCAAAACCGGACTTTAGATCTTCTGTAAGGG
TCTTGTGGCAATAGTTGTGGACCGTTTCTCCACGTTTCGTCGATGTATTCAATGATAAACAGGGATTCAGAGATCGGTTTACCTCT
GTGGACGAGAACTGGAACCTTCTTGTGAACCGGGTTGTGTCGGAGAAGGGTTTGGTTCTTGTTATGGAGATCTTCTTGCACGAATT
GGTAAGGTATGGATTTAAGCTTGAGGGCTAGCTCAACCCTTTTGCTGTAAGGACTCATGAATGTTCCATGGAGTATCAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567805 Ribosomal protein L22p/L17e family protein [Arabidopsis thaliana]10714e-114
NP_564605 Ribosomal protein L.2/L17e family protein [Arabidopsis thaliana]10688e-114
XP_002891694 ribosomal protein L22 family protein [Arabidopsis lyrata subsp. lyrata]10652e-113
NP_851249 glutathione S-transferase tau 9 [Arabidopsis thaliana]10212e-108
XP_002866495 glutathione S-transferase tau 9 [Arabidopsis lyrata subsp. lyrata]10169e-108

Swiss-Prot top hits (Blast detail)Scoree value
P46421 Glutathione S-transferase 103-1A3802e-035
P32110 Probable glutathione S-transferase3372e-030
P46417 Glutathione S-transferase 33157e-028
P50471 Probable glutathione S-transferase MSR-13093e-027
P25317 Probable glutathione S-transferase parA3032e-026

TrEMBL top hits (Blast detail)Scoree value
Q8LDU0 At4g2836010712e-114
Q56W16 AT1G52370 protein10685e-114
Q9FUT0 Glutathione S-transferase10212e-108
Q9C828 Chloroplast 50S ribosomal protein L22, putative; 25606-243748562e-089
C0Z2A0 AT4G28360 protein7811e-080

Arabidopsis top hits (Blast detail)Scoree value
AT1G52370.1 ribosomal protein L22 family protein10738e-117
AT1G52370.2 ribosomal protein L22 family protein10738e-117
AT1G52370.3 ribosomal protein L22 family protein10738e-117
AT4G28360.1 ribosomal protein L22 family protein10711e-116
AT5G62480.1 ATGSTU9 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE TAU 9); glutathione transferase10218e-111

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  25%
 
103  19%
 
122  13%
 
82  13%
 
64  25%
 
201  6%

Unigene MembersMember information