Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17181

FASTA Sequence
Unigene ID: UN17181Length: 1203  SNP
TTTTTATAGACAAAGAGGGGAAACAGAAGCCTTTATCCTGTGAGCAGCAACAATGGTGAAGGCAACAAAGGCGGAGAAGAAGATCG
CTTACGACGCGAAGCTATGTCAGCTCATCGACGAGTTCACTCAGATCCTTGTCGTCGCCGCCGACAACGTCGGATCGACTCAGCTG
CAGAACATCAGGAAGGGTCTTCGTGGTGACTCAGTGGTGCTCATGGGGAAGAACACCATGATGAAGCGTTCGGTTAAGATTCACGC
TGAGAATACCGGAAACACTGGAATCCTCAATCTCATGCCCCTCCTTCAGGGAAATGTTGGTTTGATCTTCACCAAGGGTGACCTCA
AGGAAGTGAGCGAGGAAGTTGCCAAGTACAAGGTTGGTGCTCCTGCTCGTGTTGGTTTGGTTGCCCCAATTGATGTGGTTGTCCAG
CCTGGAAACACCGGTTTAGATCCATCCCAGACATCTTTCTTCCAGGTTCTTAACATCCCAACTAAGATTAACAAGGGTACAGTCGA
AATCATCACCCCTGTCGAGCTCATCAAGCAAGGCGACAAGGTCGGTTCTTCTGAGGCCGCCCTTCTAGCCAAACTTGGAATCAGGC
CGTTTTCATACGGTCTTGTTGTCCAGTCTGTTTACGACAATGGCTCAGTCTTCAGCCCAGAGGTTCTTGATCTCACAGAAGACGAC
CTTGTCCAGAAGTTTGCTGCTGGTATCTCCATGGTCACTTCCTTGGCTCTAGCCATCTCTTACCCTACCCTTGCTGCCGCCCCGCA
TATGTTCATCAATGCCTACAAGAATGCATTGGCTATCTCTGTTGCCACTGAGTACACTTTCCCACAAGCAGAGAAGGTCAAGGAGT
ACTTGAAGGATCCTAGCAAGTTTGCTGTTGCTGTAGCGGCGGTGTCTGCAGATGCAGGTGGTGGTGCTTCAGGTGGAGCTGCCAAG
GTTGAGGAGAAGAAGGAAGTTGTTGAGGAATCAGATGAAGAAGACTACGGTGGTTTCGATATGTTCGGTGATGAATAGATTAAAAA
TATATCTATCGAGGCTATGTTTTTGTCGATGCTACACAAGTGTTGCTTCTTTACAAACGATGTTTTCAATGTTCTTGATTTTGACA
AATTCAGATTTATGTTATTGTCTTTTTAGTATGAAGAAGTTTTCGTTTCTTTTTAGATGTTTAAATGTTTTGATCATTTCATCAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882720 60S acidic ribosomal protein P0 [Arabidopsis lyrata subsp. lyrata]14654e-160
NP_187734 60S acidic ribosomal protein P0-3 [Arabidopsis thaliana]14621e-159
AAM65265 60S acidic ribosomal protein P0-C [Arabidopsis thaliana]14602e-159
XP_002884720 60S acidic ribosomal protein P0 [Arabidopsis lyrata subsp. lyrata]14583e-159
NP_187531 60S acidic ribosomal protein P0-2 [Arabidopsis thaliana]14531e-158

Swiss-Prot top hits (Blast detail)Scoree value
P57691 60S acidic ribosomal protein P0-314624e-161
Q42112 60S acidic ribosomal protein P0-214535e-160
O04204 60S acidic ribosomal protein P0-113049e-143
P50346 60S acidic ribosomal protein P012984e-142
P41095 60S acidic ribosomal protein P012537e-137

TrEMBL top hits (Blast detail)Scoree value
B9SLK4 60S acidic ribosomal protein P0, putative13425e-146
B7FJF1 Putative uncharacterized protein13417e-146
B9HSR0 Predicted protein13255e-144
A9PF35 Putative uncharacterized protein13193e-143
B9HHM2 Predicted protein13112e-142

Arabidopsis top hits (Blast detail)Scoree value
AT3G11250.1 60S acidic ribosomal protein P0 (RPP0C)14633e-162
AT3G09200.1 60S acidic ribosomal protein P0 (RPP0B)14534e-161
AT2G40010.1 60S acidic ribosomal protein P0 (RPP0A)13048e-144
AT3G09200.2 60S acidic ribosomal protein P0 (RPP0B)11578e-127

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
117  19%
 
88  22%
 
94  11%
 
125  14%
 
64  11%
 
71  3%
 
108  22%

Unigene MembersMember information