Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17183

FASTA Sequence
Unigene ID: UN17183Length: 1367  SNP
AATCAAGTAGAACTTTTAATTTCTGAAATCAAAATGTCTTAATAAATAAAAATTACAGAGTAGAGAAAATAAAATATGATATATAT
ATAGAAGCTTACAGAAATTAAACCCTACAAGACCTTTTTCTTTACATTAAAAAAGGTTTCCAAGAATCATGAATTTCAATAAAGAA
AAAGACTTTCCGAAACTTATACCTCAAACAAACTCAAGCACTTGAACCGGTCATGTCAACATACTACTTCCGGCAGCTGACTGTGC
CGGTTTGATCAAAGAAACAAAGCTATTGACTAGTAAACCGGTAAGAGATAAGCGTGGATCCGGTTTAGTTCTGGTGTCATGACAGA
AGCATCACAAGAACCATAGACAATACAAAGACCACCAAACGTTTCACTTCCTCATTGTACAGACTGGGTTGGGAGGAGGCTGCAGC
AGGAAGAGCAGGGATTCTAACAGGTTTTTTACAGGTAGAGGCTGAGGATTGAGAAGAAGAAGGCCATGGGGCTGGAATGTTGTCAT
TGAGATCACAAGTGAAGCTTATTCCAGTGTCTTGATCGAATATAGCATCGGATGGTAAGCTTGGTAATAGACAACCAGATTCTTGG
TTTCCAACTTGAAGGGAGAAGTCTTTGAGACTTATATGACAAGCAGTGAAGACATTCTTAGTGATGTTTAGCTTCTGAAGCTTTGT
CCCAAGAGAGGTTGCGCAATCCAATGCTTGCAAGTTAGTTATAAGCGATTGCTTCTGCAGATGAGACACGTAGCTCTCCATTGCCC
GGCAGCAACTCGTTTGGTTACTCAACTCGTTGCTGCAGTTACCACTGATGTGTCTCATGTGCGGAAACACAAGAGGACAAACTCTA
TTGATTTTGCAGTTTGCTAAACCTCTGAGAGTTTCCTTAGCCTGAGAAGGGTTCAGTTTAGTAGCAAGCCAACGGTGAACTACGTT
CTTGCAATCACTGATCCTATCCGAGTTATCCATCAAAGGCTCAGATGCTTTCACAGTAATATTCGTAGCTGCGTCGAGTATGGCGT
TTTGGCAAGCCTGCTCGCAACACTCCTTGACAGGATCAACTCTCTCGCAAGCCAAAAGAAGCTTAGACGTATCCACCGCGCTTTCG
AACTCATCCACGTCGATCACAGGGCAGGAAGAAGCGGTGAGATTCGACGAGCGAAGCGAACATATCCTCCCGAGCTCGCCGGAACC
GCCTCTGCCCACCAAGATCTGCTCTAAATCCGAGAGACAGTGCTTAGACTGAGTTCTGTTTAGTGCAAGGAGACCGGTCTCTTCGC
TAGCTTTGCCGAGGATGATGGTGAGAGTAGCGTCTAGCTGAGGACAGCACATGACGTGGCTAACAGGGAGCGAAGAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_176382 uncharacterized protein [Arabidopsis thaliana]15741e-172
XP_002886500 hypothetical protein ARALYDRAFT_475141 [Arabidopsis lyrata subsp. lyrata]15499e-170
AAC28508 ESTs gb|AA728658 and gb|N95943 come from this gene [Arabidopsis thaliana]15382e-168
NP_001185289 uncharacterized protein [Arabidopsis thaliana]15382e-168
NP_974068 uncharacterized protein [Arabidopsis thaliana]14234e-155

Swiss-Prot top hits (Blast detail)Scoree value
Q8GUI4 Uncharacterized GPI-anchored protein At1g6190015745e-174

TrEMBL top hits (Blast detail)Scoree value
B9RXM0 Putative uncharacterized protein11779e-127
Q0D977 Os07g0102300 protein10075e-107
B6T900 Putative uncharacterized protein9994e-106
C5X733 Putative uncharacterized protein Sb02g0003659969e-106
Q69L85 Putative uncharacterized protein B1026C12.339762e-103

Arabidopsis top hits (Blast detail)Scoree value
AT1G61900.1 unknown protein15753e-175
AT1G61900.2 unknown protein14231e-157
AT2G30700.1 unknown protein6982e-073

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  18%
 
111  9%
 
71  9%
 
211  9%
 
121  9%
 
92  18%
 
183  27%

Unigene MembersMember information