Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17190

FASTA Sequence
Unigene ID: UN17190Length: 830 SSRSNP
GGACCAGAGAACATAGGAAATGTTGTATAAAACAGAAGCAGACCCAAACTTAATCAGTACAATAATAGTAGTAACAAGAATATTAA
CAGTTAACAGATAAAAAGATAAATTTTGTTTTCTGGAAATAAAAGAGATTCTAGTAAGTGTCTCAAAGGTGCCAAAATGAGGAGTT
TTTTTTAATCACCCGATTACATTTAAACACAATCACAAAAGACCACAAAAGATTCAGAGGTTTGTCATCAGTTTCGGTGTGTTCCG
TTCTGATGTTTTTAGACAATGGGAGGATACTGCTTGGACTGTAGCTTAACCCGTTTCTTGTACTCAACTGCATCCTGGATGAAGAG
ATGATAACCATCAGTCTGTGCAGGGTCAGCGGGATTAGGGGTGTCAAGTAAATCCTGGATACCGACAAGAATCTGCTTCACTGTGA
TGGCTGGTCTCCATCCCGAATCCTCGTTAAGGATGGAGAGACAGACAGTCCCCGATGGATAGACATTAGGGTGGAAAAAGCCTTGT
GGGAATTTGCATTTGGGAGGCTTGCTCGGATAGTCCTCGCTAAAGTGCATCGTCAATGGAAAGAATCCACCTTCCCAATCAGTACC
GGCTTTACCAGGAATAGTGCAATGCCACACCATTAGATTCACAGAACCATCAGCCCCAGTCTCCGGCTTCGCCACAAAACCATGAG
GATGATTCTTCCTCCACGACTTTCTCTCCTCAGCCAAACGACCACGAGCGATTCCACTAGCCATCTCTCTCTCTCTCTTAAGACAA
TCTCTGTTGTGCTTTTCACTCTCTGTCTTCGTCTCTCTCTATATAACTCAACGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ADP37981 ubiquitin-protein ligase [Brassica napus]8765e-092
NP_191346 SUMO-conjugating enzyme SCE1 [Arabidopsis thaliana]8514e-089
CAE45567 SUMO E2 conjugating enzyme SCE1 [Nicotiana benthamiana]8291e-086
NP_001048802 Os03g0123100 [Oryza sativa Japonica Group]8263e-086
ACJ83979 unknown [Medicago truncatula]8245e-086

Swiss-Prot top hits (Blast detail)Scoree value
Q9NGP4 Sumo-conjugating enzyme ubc96012e-061
Q9DDJ0 SUMO-conjugating enzyme UBC9-B5699e-058
P63283 SUMO-conjugating enzyme UBC95699e-058
P63279 SUMO-conjugating enzyme UBC95699e-058
P63280 SUMO-conjugating enzyme UBC95699e-058

TrEMBL top hits (Blast detail)Scoree value
Q42551 Ubiquitin carrier protein8513e-089
Q70I24 Ubiquitin carrier protein8299e-087
A2XBW9 Ubiquitin carrier protein8262e-086
Q8H8G9 Ubiquitin carrier protein8262e-086
B7FGV0 Ubiquitin carrier protein8243e-086

Arabidopsis top hits (Blast detail)Scoree value
AT3G57870.1 SCE1 (SUMO CONJUGATION ENZYME 1); SUMO ligase8521e-091
AT2G02760.1 ATUBC2 (UBIQUITING-CONJUGATING ENZYME 2); ubiquitin-protein ligase2874e-026
AT1G14400.1 UBC1 (UBIQUITIN CARRIER PROTEIN 1); ubiquitin-protein ligase2849e-026
AT1G14400.2 UBC1 (UBIQUITIN CARRIER PROTEIN 1); ubiquitin-protein ligase2849e-026
AT5G62540.1 UBC3 (ubiquitin-conjugating enzyme 3); ubiquitin-protein ligase2831e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
128  31%
 
119  35%
 
103  12%
 
62  8%
 
81  4%
 
201  4%
 
92  8%

Unigene MembersMember information