Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17200

FASTA Sequence
Unigene ID: UN17200Length: 1304 SSRSNP
GGACACTATCACATTGTCTCTTCTCTCCTCCCAATCACACTACACTAAACATCATGGCTTTCGCCACTAGAAGCTCTCTCTTCGTC
TGCTTCACAACACTTGTTCTTCTCTCCACTCAAATCAATGCAAGAGAGAGCTACTTCTTTGGCAAATTCCACCGAGAATCCCCCAA
AGACCAAAACCCTAACAATGTCCTCCCTCTCGAGACCAGCGAGAAAACCACAGTAGAAGAATCCTTCCCAAACAAGAAAGAGCAAG
AACAAGATCCTACCTTCGTCCCCGAGTCCGAGAACGGCTATGGCTTATATGGTCACGAGACCACCTACAACAACAAAGAAGAGTTC
AACAACAAGGACAACAAGTACGATGAAAAATTCAACGGTGAGACTTTCTCAACTCCAAGCCTGAGCGAGACCGAAGAGTCTTACAA
CAACTACGAGGAGAACTACCCGAAGAAGACCGAGAGCTACGACAACAACCGTTACAACAACGAAGAGTTCAACAACAAGTACGATG
AAAACGTCAAGGAAGAGTTCAACAACAACAACAAGTACGATGAAAACTTCAAGGAAGAGTTCAACAACAACAAGTACGACGAAAAC
TTCAAGGAAGAGTCATTCTCTGAGAACAATGAAGACAAGAGAGGTATCTACAACTCCAACGCTTACGGAACGGAGTTAGAGCGTGA
AACGCCTTACAAAGGTTACAGCCACAACTTGGAGAGACAAGGCATGAGTGACACAAGGTTCATGGAAAAGGGTAACTACTACTATG
ACCTTTACAACGACAGAAACCACGGCCATTTCTACCGGAAGCCTCATCAGAAAAGCCCTGCCGGTTATTATTCTTCTCAGGCGACC
GAGAATAACTACGACCAGTCGTACAACAACTACAACAATGAGGAGGAGAAGAGCTTCAAGGATCAGTACAATTCCAAGTGGGAGAA
GAACATGATGAACAAACAGCCTGAAGAGTTTGTTGAGGAGCAAGGAGATCAGTTCAAGCCTTGATGAAGATTTGATGTTTGATTTC
CTCTCAAGATCATTACAATCTTAAAAGTGTTTTCTTTTATTTCAACTAAGTTATTTTACTTCTGGTTGATTAGTCAAACTAAGTCG
TTGTTATCATTGCAAGTGAAAAAGGGAAAAGGGGAGGGGTCTGTGTTTTCTTTTAGTTGAAATGGGTTTGCTTTTTATGGGATTTT
GAACTTTGATGTTTGCGTTTGCATATAATATTCGAAGAAAAGATAGTAAAATATATGGTGTTACTTTATGTTATTTTCTTATGTTG
ATCACTTTTTGGTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002893529 hypothetical protein ARALYDRAFT_473059 [Arabidopsis lyrata subsp. lyrata]13607e-148
NP_174162 uncharacterized protein [Arabidopsis thaliana]13562e-147
XP_628559 cryptopsoridial mucin, large thr stretch, signal peptide sequence [Cryptosporidium parvum Iowa II]2962e-024
CBY15049 unnamed protein product [Oikopleura dioica]2891e-023
XP_626655 very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II]2819e-023

Swiss-Prot top hits (Blast detail)Scoree value
P47179 Cell wall protein DAN42431e-019
Q6S6W0 Glycoprotein gp22171e-016
P28968 Glycoprotein gp21963e-014
Q54VM3 TBC1 domain family member 5 homolog A1882e-013
Q05049 Integumentary mucin C.1 (Fragment)1873e-013

TrEMBL top hits (Blast detail)Scoree value
Q9SGN8 F3M18.1613561e-147
Q5CY21 Cryptopsoridial mucin, large thr stretch, signal peptide sequence2961e-024
O96503 GP9002843e-023
Q5CV09 Very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long)2816e-023
A9VE65 Predicted protein2808e-023

Arabidopsis top hits (Blast detail)Scoree value
AT1G28400.1 unknown protein13576e-150
AT2G33850.1 unknown protein4751e-047
AT1G03820.1 unknown protein1362e-008
AT5G01280.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 40332 Blast hits to 19265 proteins in 905 species: Archae - 97; Bacteria - 3595; Metazoa - 17370; Fungi - 8276; Plants - 837; Viruses - 1209; Other Eukaryotes - 8948 (source: NCBI BLink).1282e-007
AT3G09000.1 proline-rich family protein1221e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
72  6%
 
105  16%
 
117  22%
 
84  13%
 
123  9%
 
202  6%
 
211  3%
 
151  3%
 
95  16%
 
62  6%

Unigene MembersMember information