Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17202

FASTA Sequence
Unigene ID: UN17202Length: 1628  SNP
GGGGTTCTCTTTTCTCTCAATCGATCGTGTAAGTGAAGACGAAGAAGATGCAGGCGGTTTCAAGGAGATTAATCCAGCGTCCTCTC
TCCGGAGGAGCTTCAACCTATTCATCATCTTCTCTCAGATCGCTCCATGGAGTCTCAGATCGCCTTAATGGAAGTGATAATCGTCG
CTACTCGTCTTCCCTGGCTACTAAGGGAGTTGGACACCTCGCTCGCAAGGGTACTGGTGGCAGATCTTCCGTCAGTGGCATTGTAG
CTACGGTGTTTGGAGCCACTGGGTTTCTTGGTCGTTATCTTGTGCAGCAACTAGCTAAAATGGGATCGCAAGTGCTAGTTCCTTTC
CGAGGCTCAGAGGACAATCCTCGCCATCTCAAGTTGATGGGAGATTTAGGACAGGTAGTACCGATGAAATTTGACCCAAGAGATGA
AGACTCAATTAAGGCTGTCATGGCAAAGGCTAATGTCGTTATCAATCTCATTGGAAGAGAGTACGAGACCAGAAATTTCAGTTTCG
AAGAGGTGAATCATCACATGGCCGAGAAACTTGCATTGGTGGCCAAGGAACATGGTGGAATAATGAGATTTATTCAAGTTTCTTGT
CTGGGAGCTTCTGTATCATCTCCTTCAAGAATGCAGAGGGCAAAGGCTGCTGCTGAGGAAGCTGTCTTGAGCGCCCTTCCTGAGGC
GACAGTCATGAGACCTGCGACCATGATTGGTACAGAGGACAGAATCTTGAACCCCTGGGCAATGTTCGTTAAGAAATATGGTTTCC
TCCCGCTCATAGGTGGTGGGACCAACAAATTCCAGCCCGTATATGTGGTTGATGTTGCTGCTGCAATTGTTGCAGCTCTCAAGGAT
GATGGCTCTAGCATGGGTAAAACCTACGAATTGGGTGGTCCAGATGTCTTTACCCCTCATGATTTGGCAGAGATCATGTTTGATAT
GATCCGTGAATGGCCTCGATATGTTAAGCTTCCATTTCCAATTGCTAAGGCAATGGCGGGTCCTCGGGATTTCATGGTGAACAAAG
TCCCGTTTCCTCTACCCTCACCCCAGATCTTCAATCTGGATCAAATCAATGCGCTTACGACAGATACACTTGTATCTGACAAGGCC
TTGACGTTTCAGGATTTGGACCTTGTCCCTCATAAGTTGAAGGGATATCCAGTGGAGTTTCTTATCCAATATCGCAAAGGTGGTCC
TAACTTCGGTTCTACTGTGAGTGAAAAGATACCAACAGACTTCTACAATTGATGCTGCTTCTGCTCCAAGGTCGTTTTCCTGGACT
AATTATTTTCTCACAATGAAATTGCGGAAACCAGATTTGGTATTTTGATGCCTTTTCATTTGCTTCTGTCAAATAATAAAATGGTT
CTCCTCTTTCTTGTGTTCTGGACAAAAAGTGTAGCACATAAGTTAGAGAGGGGGCGATATCTGTCTTGATGGGACGATTTGGTCCC
CTTAAAAATTATGCATTTTCAAACTTCATGTGCCACTATGCTCTTGAGTATAACTAAAGTGTCATGTGTTTTGGTCTTTGCATTCC
ATATAGCTCAGAGTTGTATGTTTTATTTGCACAAAGACGTTTCAACTTGTACCTGTGTTCAATATAAGTTAAACCTTGGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884196 catalytic/ coenzyme binding protein [Arabidopsis lyrata subsp. lyrata]19432e-215
NP_565469 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 9 [Arabidopsis thaliana]19371e-214
BAH20309 AT2G20360 [Arabidopsis thaliana]16531e-181
XP_002321296 predicted protein [Populus trichocarpa]15713e-172
ACU23211 unknown [Glycine max]15661e-171

Swiss-Prot top hits (Blast detail)Scoree value
Q0MQB3 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5478e-055
Q16795 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5478e-055
P0CB81 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5461e-054
P0CB82 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5461e-054
P34943 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial5451e-054

TrEMBL top hits (Blast detail)Scoree value
Q9SK66 Putative NADH-ubiquinone oxireductase19378e-215
B9DHU2 AT2G20360 protein (Fragment)16537e-182
B9IBC6 Predicted protein15712e-172
C6TJX1 Putative uncharacterized protein15669e-172
B9GRC3 Predicted protein15651e-171

Arabidopsis top hits (Blast detail)Scoree value
AT2G20360.1 binding / catalytic/ coenzyme binding19374e-217

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
75  24%
 
121  5%
 
88  38%
 
111  5%
 
212  10%
 
103  14%
 
91  5%

Unigene MembersMember information