Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17205

FASTA Sequence
Unigene ID: UN17205Length: 2047 SSRSNP
CTGATTCCTTCGAGTGGTGAAGAAGCTAAGCGCTATGGGGCTACCTGCGTCGAAGCGTAATCAGCGTCAATGGAGCCTCCTCGACA
TCGTAACGGCCGCCTTCTTCGGCATCGTCCTTCTCTTCTTCATCTTACTCTTCACTCCTCTCGGCGATTCCATGGCCGCCTCTGGT
CGCCAAACGCTGCTCCTCTCCACCGCCACAGATCCGAGGCAACGTCAGCGGCTCGTGACTCTGGTTGAGTCAGGTCATCATTTGCA
GCCGATCGAGTATTGTCCGGCGGATGCGGTTGCTCACATGCCTTGCGAGGATCCGAGGAGGAACAGCCAGCTTAGTCGAGAGATGA
ATTTCTATCGGGAGAGACATTGTCCCTTGCCCGAGGAGACGCCTCTCTGCTTGATTCCTCCTCCTTCTGGTTATAAGATCTCTGTT
CCCTGGCCTCAGAGCCTACACAAGATATGGCATGCAAACATGCCGTACAACAAAATTGCAGACAGGAAAGGGCACCAAGGATGGAT
GAAAAGGGAAGGTGAATACTTCACTTTCCCTGGTGGTGGCACCATGTTTCCTGGTGGTGCTGGCCAGTACATTGAAAAGCTTTCTC
AGTATATTCCTCTTATGGGTGGAGTTCTCAGGACTGCCCTTGACATGGGATGCGGGGTCGCAAGTTTTGGAGGTACTCTACTGTCT
CAAGGGATTCTAGCTCTCTCGTTTGCTCCAAGAGACTCACATAAATCGCAGATTCAGTTTGCCTTGGAAAGAGGAGTCCCTGCATT
TGTTGCCATGCTTGGCACTCGTAGACTCCCCTTTCCTGCTTCCTCCTTTGACCTTATGCATTGTTCCCGATGCTTGATACCCTTTA
CAGCTTACAATGCAACTTACTTCATCGAAGTAGATAGGTTACTGCGCCCTGGAGGTTATCTTGTAATCTCTGGCCCACCTGTTCAA
TGGCCTAAACAAGACAAAGAATGGGCTGATCTTCAAGCCGTGGCTAGAGCTTTGTGCTATGAGCTAATTGCTGTCGATGGTAACAC
TGTCATCTGGAAGAAGCCTATTGGAGATTCATGTCTCCCCAGCCAAAACGAGTTCGGCCTTGAGTTGTGTGATGAGTCTGAGCCAC
CAAGTGATGCATGGTATTATAAGTTAAAGAGGTGTGTTACTAGACCATCATCCGTCAAAGGAGATAATGCTTTGGGAACTATTCCC
AAGTGGCCGGAAAGGCTTACTAAAGTTCCTTCTAGAGCCATTGCCATGAAAAACGGGTTCGATGTGTTTGAAGCAGATGCAAGGAG
GTGGGCAAGACGAGTTGCTTATTACAGGGATTCCCTGAGCTTGGAGCTGAAATCTCCAGCTGTCCGCAATATCATGGACATGAACG
CATTCTTTGGAGGATTTGCTGCAACCCTTGCATCTGAGTCTGTGTGGGTTATGAATGTGATCCCAGCTCGGAAACCTTTAACTCTT
GACGTGGTTTACGACAGAGGTCTCATCGGTGTTTACCATGATTGGTGTGAGCCTTTTTCAACATATCCTCGTACGTATGATTTCAT
TCACGTATCAGGAATTGAATTTCTGATAAAACGGCCAGACTCAAGCAAATCGAGGTGTAGCCTAGTAGATCTGATGGTAGAGATGG
ACAGAATATTGCGTCCAGAAGGAAAGGTTTTGATCCGAGACTCTCCAGAGGTGCTAGACAAAGTAGCAAGAATGGCTCATGCTGTA
AGATGGTCTTCTTCCATACATGACAAAGAACCTGAATCCCATGGAAGAGAGAAGATACTTGTTGCTACCAAACCTTTCTGGAAAAT
GCCATCAAACTCCCACTAAAGAACACACAGAAAGAAACAAAAAGAAAAAGAAAAGAGAGAGAGAGAGAGAAGAGGAAGGTCTTCCC
AGACTTGTAGGTAACAGTCACTTTCTCTCCAGCCCCCATATGTCTGTCCTTAAAACACCATCCTGATGATATACTTTTTTGTGTGT
GTTCGTGACATTGCTTCCAAAATGTATCGCAATCGTATAATGTTAATTCTTGATCACACGTTGTTCTGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567184 putative methyltransferase PMT13 [Arabidopsis thaliana]30090.0
XP_002872932 hypothetical protein ARALYDRAFT_490495 [Arabidopsis lyrata subsp. lyrata]29900.0
XP_002320756 predicted protein [Populus trichocarpa]26092e-292
XP_002272714 PREDICTED: hypothetical protein [Vitis vinifera]25975e-291
ABN08824 Protein of unknown function DUF248, methyltransferase putative [Medicago truncatula]23224e-259

Swiss-Prot top hits (Blast detail)Scoree value
Q93W95 Probable methyltransferase PMT1330090.0
Q94EJ6 Probable methyltransferase PMT1411974e-130
O22285 Probable methyltransferase PMT1110918e-118
Q8H118 Probable methyltransferase PMT110684e-115
Q93YV7 Probable methyltransferase PMT310641e-114

TrEMBL top hits (Blast detail)Scoree value
B9IC56 Predicted protein26091e-292
A2Q5C4 Putative uncharacterized protein23222e-259
B9RDL1 Putative uncharacterized protein23043e-257
A9NXM2 Putative uncharacterized protein21011e-233
C0JJG7 Dehydration responsive protein20222e-224

Arabidopsis top hits (Blast detail)Scoree value
AT4G00740.1 dehydration-responsive protein-related30100.0
AT4G18030.1 dehydration-responsive family protein11974e-131
AT3G23300.1 dehydration-responsive protein-related10683e-116
AT4G14360.1 dehydration-responsive protein-related10641e-115
AT4G14360.2 dehydration-responsive protein-related10641e-115

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
212  11%
 
121  5%
 
64  21%
 
86  32%
 
191  5%
 
181  5%
 
102  11%
 
91  5%
 
111  5%

Unigene MembersMember information