Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17266

FASTA Sequence
Unigene ID: UN17266Length: 1450 SSRSNP
CTTCTTCTCTCGTCTCTAAATATTTCTGGAAGCAGCAGCATTCAACTGTACTGCAGATTCGATCGAAGTTTATTAGATCCGGGATT
TTCCTCCCTATATATTTGTATAAAACTAAGAAAAAAGTTTCGATTTCTTTAAGCGCAGTTCGTGTTTGAATCCGCTTGAAATTAGA
AAAACAAAAAAACATATTCTTTAGGGTTTTGGTTTAGTTTCGACTGTGGGTGTTGGATTAATATATATATATAAATATGGATAAGA
AGAAGGTCGCCGTTCCACTTGTCTGCCATGGCCATTCAAGACCTGTTGTTGATTTGTTCTACAGTCCAATTACCCCTGATGGTTTC
TTCCTCATCAGCGCCAGCAAAGATTCACATCCAATGTTGAGAAACGGGGAGACTGGAGACTGGATTGGTACCTTTGAAGGTCATAA
AGGTGCGGTGTGGAGTTCTTGCCTCGACAACAACGCTCTACGTGCTGCTTCTGCTTCTGCTGATTTTTCAGCGAAACTCTGGGATG
CGTTAACAGGAGATGTGCTGCATTCTTTTGAGCACAAGCATATTGTTCGAGCGTGTGCCTTCTCAGAGGATACAAAATTGCTGATC
ACTGGAGGATTTGAGAAGATTCTTCGTGTATTTGACTTGAACCGGTTGGATGCACCTCCCACAGAAGTCGATAAATCTCCTGGATC
CATCAGAACCCTCACATGGCTTCACAGTGATCAAACTATATTAAGTTCTTGCACTGATATTGGTGGCGTGAGGTTATGGGATGTTA
GGAGTGGGAAGATTGTGCAGACATTGGAGACAAAGTCTCCTGTCACCAGTGCTGAAGTGAGCCAAGATGGACGATACATTACTACT
GCTGATGGGTCAACTGTTAAATTCTGGGACGCTAACCATTTTGGACTAGTGAAGAGTTATGACATGCCATGCAATATTGAGTCTGC
ATCTCTGGAGCCTAAATCTGGTGAAAAGTTTGTAGCTGGCGGTGAGGATATGTGGGTCCGAATGTTTGATTTCTACACCGGAGAGG
AGATTGGATGCAACAAGGGGCATCATGGTCCGGTACACTGCGTGAGGTTTTCACCGACGGGTGAGTCGTACGCCTCGGGGTCTGAA
GACGGGACCATCAGGATCTGGCAGACGACACCAAACCATAGTGTGGATGAAGTGGCTAAGAAGATTGAAGGCTTTCACATCAACAA
AGAAGGAAAACCCGCAGAGAAAGTTTCTGATGCTTAGGCAGAAGAACACGGAAAAAGCCTTTTTCTCTTAGTTCTTGATGCGCTAT
GTTTCGTGTGTGTTTGTGTTTCCTGACTGAATATACAGAGAAAAAGAAAAACACAAGGACCGGACCTTTCCTTATCTTTTAGTTTT
TCTTGGATCTTTTTCGTTATTATATAAAACCTTGGGACCTGTTGTGCAATTTATGAAATAATTTGACTTTTGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002891712 transducin family protein [Arabidopsis lyrata subsp. lyrata]15883e-174
NP_849800 transducin/WD-40 repeat-containing protein [Arabidopsis thaliana]15822e-173
NP_566519 transducin/WD40 domain-containing protein [Arabidopsis thaliana]15651e-171
XP_002885098 transducin family protein [Arabidopsis lyrata subsp. lyrata]15632e-171
XP_002298116 predicted protein [Populus trichocarpa]14915e-163

Swiss-Prot top hits (Blast detail)Scoree value
Q54LT8 Serine-threonine kinase receptor-associated protein7896e-083
Q5ZL33 Serine-threonine kinase receptor-associated protein7653e-080
Q9Y3F4 Serine-threonine kinase receptor-associated protein7611e-079
Q5E959 Serine-threonine kinase receptor-associated protein7601e-079
Q9Z1Z2 Serine-threonine kinase receptor-associated protein7601e-079

TrEMBL top hits (Blast detail)Scoree value
Q9SSS7 AT1G52730 protein15821e-173
Q9LW17 Expressed protein15651e-171
B9GKZ1 Predicted protein14914e-163
B9GWN6 Predicted protein14824e-162
B9RUZ3 Serine-threonine kinase receptor-associated protein, putative14701e-160

Arabidopsis top hits (Blast detail)Scoree value
AT1G52730.2 transducin family protein / WD-40 repeat family protein15826e-176
AT1G52730.1 transducin family protein / WD-40 repeat family protein15826e-176
AT3G15610.1 transducin family protein / WD-40 repeat family protein15655e-174
AT1G15470.1 transducin family protein / WD-40 repeat family protein13433e-148
AT2G46280.3 TRIP-1 (TGF-BETA RECEPTOR INTERACTING PROTEIN 1); nucleotide binding / protein binding1741e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  24%
 
213  14%
 
192  10%
 
182  10%
 
202  10%
 
72  10%
 
81  5%
 
112  10%
 
92  10%

Unigene MembersMember information