Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17283

FASTA Sequence
Unigene ID: UN17283Length: 535  SNP
TTTTTTTAATAAATGACGTATAAAATAGTCAATCAAGTTATGGTGTCTGAGTAGGGTATGAGGAAGATATATGGAAAAGACGAAAC
ATAAAAGAAGTAAGGAATAGAAGAACACATTTATTTATTTTTATTAATCAGCATTACATAAAATTTGTCTGATCATAATCAAATTA
TTAGCTCTTCCGTATTATTCACTTTGCCTGTCTAAACAACACGTTCAAAATCGGACATGGTAGAGAAATCAATTTTTTTTGGTATA
AGCTTAATTTAGTTCAAGTAGTAGGTGAAGAGAGACACAAGGGAAGCCCCAACCAAAGAGCCAAGAGCCGGTACGGCTACAGAGGC
TCCGCTTGCGGCGGGTCCTGGTGCTGGAGCTCCAACTTCTGTTGCCATGACGGCGGTCATGGAAGCAGCAGCGAAAAGAACTCCGC
AGGCAATCTTCTTCATCTCCATTTTTAGTTGAGACCTGAAAGGGTTTATTTTCTTCTTTTTGTTTGGTAGTTTTGTTACTTTTTTT
TGTTTCTTGCAGGTCTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_973662 uncharacterized protein [Arabidopsis thaliana]2831e-023
XP_002879957 expressed protein [Arabidopsis lyrata subsp. lyrata]2793e-023
XP_002876432 expressed protein [Arabidopsis lyrata subsp. lyrata]2613e-021
NP_191328 arabinogalactan protein 23 [Arabidopsis thaliana]2417e-019
AAM18712 arabinogalactan-peptide AGP23 [Arabidopsis thaliana]2354e-018

Swiss-Prot top hits (Blast detail)Scoree value
Q8S2W4 Arabinogalactan peptide 232414e-020

TrEMBL top hits (Blast detail)Scoree value
Q3EBI2 At2g419052837e-024
Q9XEY8 Pollen-specific arabinogalacta protein BAN1022236e-017
B9HNM7 Predicted protein1968e-014
B9N6U6 Predicted protein1781e-011
B9II47 Predicted protein1725e-011

Arabidopsis top hits (Blast detail)Scoree value
AT2G41905.1 unknown protein2844e-026
AT3G57690.1 AGP23 (ARABINOGALACTAN-PROTEIN 23)2423e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  10%
 
614  29%
 
79  19%
 
92  4%
 
84  8%
 
1213  27%
 
111  2%

Unigene MembersMember information