Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17308

FASTA Sequence
Unigene ID: UN17308Length: 1282 SSRSNP
GGGAATAATAAAAATAATTAAGCAAAAAATTCTTTTTTTGTATCAAATCAAATAAAAACCCTAAAATTGAAGAAATAATTGTTGAG
ATCGCCGTTTGGATCGGGTTTCTATGAACCCATCGGAAAACTAAAAAAAAAAAAAAGAGAGAGAGAGAGAACCAAACTGAGAGTTT
CTCTCCTGTTACTTTCGACGCTTCCAACCTCTTACCTATGTCCGAATGAAATCATCAATTACGAACAAGGAATGACGAGTAGCTCG
TCATCTAAGAAACAAGCTCAAGATCCGCCTGAATCCTCCGAGCCCACTTTGAAATCCCTCAGAACCAAGATGACCAAATCCGACGA
AAAGAAGAAGCTTAAAGACATTGAGATAAGCGTTCCACTTGTCTATGGTAACATTGCTTTCTGGCTCGGCAAGAAGGCTAGCGAAT
ACCAATCTCACAAATGGGCTGTATATGTTCGTGGGGCAACAAACGAAGACATCAGTGTTGTAATCAAGAAAGTCGTCTTCCAGCTT
CATTCTAGTTTCAACAACCCAACAAGAGTCATCGAGGAGCCTCCTTTCGAGGTGTCCGAATCTGGCTGGGGAGAATTCGAGATTGC
TATCACATTGCATTTCCACAGCGACGTCTGTGACAAGCCATTGAGTTTATATCATCACTTGAAGTTATACCCAGAAGATGAATCAG
GTCCTTTGACAATGAAGAAGCCTGTGGTTGTCGAACACTACGACGAGATTGTGTTTCCTGACCCTTCTGAAAGTTTTCTTGCTAGG
GTTCAGAATCACCCTGCTTTGACGTTTCCTAGATTACCCTCTGGTTACAACTTGCCTGCTCCTATGCAAGTTGATGATAACGGGAA
AAAGAAGAGAGGTGATACTAAAGATCATAGCTTGGGACAATGGTTCACGAGCTTCTCTGAAGCCGATGAGTTGTTACAGCTTGCGG
CTGCTCGTCAACAGGTTCAAGCTCATATTGCTAAACTCAGGCGACAAATAAGCTTGCTAGAGGGACAGAATCAGACCATCAAAACA
GGTTCTGATCCGTGAAGCTGTAGCCAGTTTCCATTGGTGGAGTGGGAGATTGGTTTTGTTGTAACATTAATGTGTATCAGTATTAT
TAGCGTAGCGCTTTTTTTTACCAGTCTTTGATACATTCTCTCTAAGAATCAGTTTGCTCGGACTGTTGACTAACTAGGGGTGGCCT
TTGAGTGTTTAGCATTTTCGGGTTTTACATGATTTCGGCTCGGGTTTGGTTCATAATATCATGGGGTTCAGTTCGTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001190475 YEATS family protein [Arabidopsis thaliana]13331e-144
NP_199373 YEATS family protein [Arabidopsis thaliana]13212e-143
XP_002865236 hypothetical protein ARALYDRAFT_494425 [Arabidopsis lyrata subsp. lyrata]13185e-143
XP_002306148 predicted protein [Populus trichocarpa]11034e-118
XP_002275472 PREDICTED: hypothetical protein [Vitis vinifera]10202e-108

Swiss-Prot top hits (Blast detail)Scoree value
Q755P0 Protein AF-9 homolog3532e-032
O95619 YEATS domain-containing protein 43414e-031
Q9CR11 YEATS domain-containing protein 43414e-031
Q5BC71 Protein AF-9 homolog2993e-026
Q10319 Protein AF-9 homolog2941e-025

TrEMBL top hits (Blast detail)Scoree value
Q9FH40 Putative uncharacterized protein At5g4560013212e-143
B9H0Z7 Predicted protein (Fragment)11033e-118
C6TC74 Putative uncharacterized protein9242e-097
B9RG64 YEATS domain-containing protein, putative9223e-097
B8B2A6 Putative uncharacterized protein9161e-096

Arabidopsis top hits (Blast detail)Scoree value
AT5G45600.1 GAS41; protein binding13219e-146
AT2G18000.1 TAF14 (TBP-associated factor 14)5791e-059

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  13%
 
124  27%
 
83  20%
 
92  13%
 
113  20%
 
101  7%

Unigene MembersMember information