Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17434

FASTA Sequence
Unigene ID: UN17434Length: 1166 SSRSNP
GGATCTGCGCCGCACTCTCTCTCTCTCTCAGATTGATTCCTCCCAAAATCAACCCTTCTCCCCCAAAGTTAATTTTTCAGTAGCAA
TCATGGCGGACGAGAATAATGAGTTGAAGGAGGTCAAGGACGAGCAAGAACTCGCACCCTTTGACCCAACCAAGAAGAAGAAGAAG
AAGAAAGTTGTCCTTCAAGATCCCATCGAGGAACCTACTGAGTCACCGGCCGAGCCATCTGATTCTTTGCCTGCTAATGATGGTGG
CCTTGACGGTCCATCTTTCGGAACCAAGAAGAAAAAGAAGAAGAAGCCTGTTGAATCAAGCTCATTGGATGATGAAAGTGTCGATG
CTCCAGAAGATTTGGAGGAGCATCCCAATGAAGAGGAAGAGGCAGAGGGAATTGATTTGCAGCAGCAGCAGCAACGTTATCCCTGG
GAGGGAAGTGATAGGGATTACATATATGACGAGCTTCTTGGTAGAGTCTTTAACATTCTCCGTGAGAACAATCCGGAGCTTGCTGG
AGATAGGCGTCGTACTGTTATGAGGCCTCCCCAAGTTCTTCGTGAAGGGACAAAGAAGACAGTGTTTGTCAACTTTATGGACCTTT
GCAAGACGATGCATCGTCAACCGGACCATGTGATGAATTTCTTGCTTGCTGAGTTGGGAACCAGTGGTTCGCTTGATGGGCAGCAA
AGATTGGTTGTCAAGGGAAGATTTGCACCCAAGAATTTTGAGGGGATTTTGCGTCGTTATGTCACTGAGTACGTCATTTGCCTTGG
TTGCAAGAGCCCGGACACAATTCTCTCAAAGGAGAATCGTCTCTTCTTTTTCAGATGCGAGAAGTGTGGATCTGGACGATCTGTGG
CGCAGATCAAAGCTGGTTTTGTTGCTCGTGTTGGTCGCAGAAAGACTTGAGGAATTGGACGGTGAACTGAGTGGTCTTTTTGTTTT
GGGAAACTACAGAGCTTGTTATGCAGTTGAAATACCTGTGTTGTTTTTTTTTGTTTTTTTTTGTTATTGTTTCTGAATGTGAGCAA
TAATCTGGAGACAAGATTTCACATCAAATATGATCAAAACCTTCTACTTTGTTAGATCATGTGGGTCACTTGAATTCTTGAAGTTC
TTTTGCTTTCAGTCAGTGCTCTTCCTCATGCAAAGCTTATTCATGTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_974817 translation initiation factor eIF-2 beta subunit [Arabidopsis thaliana]10944e-117
NP_197592 translation initiation factor eIF-2 beta subunit [Arabidopsis thaliana]10838e-116
AAK29672 protein synthesis initiation factor eIF2 beta [Arabidopsis thaliana]10838e-116
XP_002874023 protein synthesis initiation factor eIF2 beta [Arabidopsis lyrata subsp. lyrata]10802e-115
CBI15806 unnamed protein product [Vitis vinifera]10765e-115

Swiss-Prot top hits (Blast detail)Scoree value
Q41969 Eukaryotic translation initiation factor 2 subunit beta10834e-117
P55871 Eukaryotic translation initiation factor 2 subunit beta9956e-107
O24473 Eukaryotic translation initiation factor 2 subunit beta9472e-101
P20042 Eukaryotic translation initiation factor 2 subunit 26131e-062
Q99L45 Eukaryotic translation initiation factor 2 subunit 26131e-062

TrEMBL top hits (Blast detail)Scoree value
Q3E987 Putative uncharacterized protein At5g20920.210943e-117
B9I766 Predicted protein10423e-111
A9PI50 Putative uncharacterized protein10389e-111
C6TAV3 Putative uncharacterized protein10371e-110
C6TP03 Putative uncharacterized protein10308e-110

Arabidopsis top hits (Blast detail)Scoree value
AT5G20920.2 EIF2 BETA; translation initiation factor10961e-119
AT5G20920.1 EIF2 BETA; translation initiation factor10842e-118
AT5G20920.3 EIF2 BETA; translation initiation factor10842e-118
AT3G07920.1 translation initiation factor5109e-052
AT5G01940.1 eukaryotic translation initiation factor 2B family protein / eIF-2B family protein3656e-035

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  20%
 
68  32%
 
82  8%
 
114  16%
 
75  20%
 
201  4%

Unigene MembersMember information