Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17448

FASTA Sequence
Unigene ID: UN17448Length: 2004  SNP
CTGCAGGAACAAAGCGGTGGCGAAAATAATACTAATGAACGTCATGGTATGAAGGTAGAGATACATTCGAAAGAGGAAGCGATTGG
CGACTGCGACTGTGGTCACGATCTGGAGGAGACAGATGTTGGAGTATCATTTGATGTGAGTTTAGCGTTCGAGGACAAGTTTGAAT
TCAATTCATGCTGGGTTGGGTCTGTAGCAAAAGGGGTTGTGCTTATCGTCCTATCTACTTTGGGAGATACCAAGTCGCCGGTCAAA
TTTATTGTTTCATCGCCAAAAAATGCGACTCATTAATATCAGTGGCGTTATTATTTAACTTTTATTGTATGGTTTCTAAGATTAAA
TAAATTCTTGTCAGTTTTTTAGTTAAATCGACGACGTTACTGTTATAAGATATAGTTTTTGAGTATTGACATGTGGGTATCTTGTT
AATGTAAATGGTGCAACTCAGCCTAGAAAACACTGAACTCGATACGTATAATTACGTTTTACTACAAATAATTTCTTGATTGTTTT
CAGGTATTTAACTTTCTGAACCAAGCAGAACTATTTTCTCTTTGATTAAGTCTCACTACTGCTGATTATCAATTTTAGGGGGAAGA
AGCAAAAGAAACTAATAAGTAATAATTGAACTGAGTTAAAAACATGCTCATACTCTTTAAATTCAAAGAAATAACAACTCCAGAGA
TGAAATCCAAGAAAAATGAATAACATAAAGTAATAACCAAAAATCTTTGCCTAAACCGGATAGAACTACTGACTGGCTCCAAGCCA
CTTGGTGAAGTTATCAAACTCTGTGTAATCACTGTCTGAGATCATAGTCTTGTACCACGCCTTGCCTGCAGCTTTAATAGCTTGTG
ACTCCTCCTTCGTGACGGGTTTCCTCTTCTTCTCGAGCTTCTCCTTCTTCGACTTAACCCTCTGCGCTTCAGCCAACAGAGACATC
CTCTTTGCCGTCTTAGAATACGGATTCAACTTAAGCATCACGTTAAGGTTCTTCAACGGGTTCTTCTTAAGCACAGCTCTCTTCGC
ATCCTTCTTAATCGGCTTCACCACACTCTGAACCTCATCGGAGTTGATAATCCTAGCCAAATCAGCGTTCACCATCTTCGCACGAG
GCAAAACATAACCCTTCTTCATCTCAGATGGCTTCTCAAACGATCCATAGATAGACTCGAGCTTCTCAAAAGCAGACTTAGTCCAG
ATCACAAACCTCCCGAGATGACCACCAGGAGCTAACTTCAACAAGTTAAGCCTCTCCACATGACAAAGCTCAACACCAGTAATGTT
CCTAAACGCTTTCACAATCTTAGCTCCTTCGGTTCCGTACACAACAAGAGGACCTTTCCGACAAACGTAACGACGGTTCCTCATCT
TACCGACACCAGACCTAATCCCGATACTGTCCTTGGCCTTCTCGGCGTCATCGTAAGCACCGATCTGCTTCAAAACCTTGATCGCA
GCGGAAGTCTTCTCCACGGCCTCAGCAGAATCGCTAACGACGAGAGGCATCTCGGGAACGTTCTCGATCTTGTGACCACGAGCCGT
CACGAGAGAAGGAACAGCTGTCGCGGCGATGGCCGAGACGATCGCGTGCCTCTTCATGTTGACGTTGACGCGACGGTGCCAGCGTC
TCGTGATCTTAGTCGGAGCGAACATCCGACCACCGCGACACATGTTTCCGAAGGCCGCTTGACCTGCGCGGTGGGTTCCACCACCG
GGAACACGAGGGATACGGGACACGGCGCGTCCGGTTCCCCAGGACTCGGCGGAGGTCTGGTGACCGGCGCGTTTGGAGACGGCGTA
AGGCTGACGGCTGTTGTTGGAGATCTGAGCGTGGACGAAGCTGACGATGTCTGGCCTCACGGGTGCGGTCATGACGTCCGGTAGAC
AGATGGTGGTGGATTGGTCGGTGGTCATGTCACCTTCGAGTCCTGGACGGAGACTAGAGGGCGTGCGGCGGCGACTGCCATTGTTT
TGGAGGGAAAGAGGGTTTGGGATCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882630 60S ribosomal protein L4/L1 [Arabidopsis lyrata subsp. lyrata]18861e-208
XP_002870995 60S ribosomal protein L4/L1 [Arabidopsis lyrata subsp. lyrata]18798e-208
NP_187574 60S ribosomal protein L4-1 [Arabidopsis thaliana]18762e-207
NP_195907 60S ribosomal protein L4-2 [Arabidopsis thaliana]18725e-207
BAC42280 putative 60S ribosomal protein [Arabidopsis thaliana]18663e-206

Swiss-Prot top hits (Blast detail)Scoree value
Q9SF40 60S ribosomal protein L4-118768e-209
P49691 60S ribosomal protein L4-218722e-208
Q9XF97 60S ribosomal protein L416931e-187
P49165 60S ribosomal protein L410845e-117
Q9D8E6 60S ribosomal protein L410675e-115

TrEMBL top hits (Blast detail)Scoree value
Q8GYH3 Putative 60S ribosomal protein18662e-206
Q8LA93 60S ribosomal protein L4-B (L1)18591e-205
Q2V3X4 Uncharacterized protein At3g09630.218545e-205
A9PJ22 Putative uncharacterized protein16977e-187
B9IIY9 Predicted protein16914e-186

Arabidopsis top hits (Blast detail)Scoree value
AT3G09630.1 60S ribosomal protein L4/L1 (RPL4A)18775e-210
AT5G02870.1 60S ribosomal protein L4/L1 (RPL4D)18731e-209
AT3G09630.2 60S ribosomal protein L4/L1 (RPL4A)18605e-208
AT5G02870.2 60S ribosomal protein L4/L1 (RPL4D)18561e-207
AT5G02890.1 transferase family protein2502e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
181  8%
 
113  23%
 
102  15%
 
63  23%
 
92  15%
 
211  8%
 
201  8%

Unigene MembersMember information