Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17464

FASTA Sequence
Unigene ID: UN17464Length: 888  SNP
GGATTCTGCGAAGAAGAATATGGCGACAGAGGATGTGAACGAAGCCCTTGCGGCGGCGGAGGTAACGGCGATTGAATCGACGAGAA
GCAGCAGCCTCCTCACAAGCTCGAAAGAAAGTGGAGTTTCTGGTTCGATAACCAATCCAAACCAAAGCAAGGCGCCGCGTGGGGAG
CTTCCCTCCGTAAAGCATGTACCTTCGATACCGTCGAAGATTTCTGGGGTTTGCACGAGACTATATTCGTTCCCAGCAGATTGACA
CCCAATGCTGACATTCACATGTTCAAAGCTGGTGTTGAGCCAAAGTGGGAAGATCCTGAGTGTGCTAACGGCGGCAAGTGGACTTA
TGTTGTTACCAACAACAGGAAGCAAGCTTTAGACAAGGCTTGGCTTGAAACTTTGATGGCTTTAGTTGGAGAGCAGTTTGATGAGT
CAGATGAGATTTGTGGTGTGGTTGCTAGTGTCCGCCAAAAGCAAGACAAGCTCTCCTTGTGGACTAGGACTAAATCTAATGAAGCT
GTTCTGATGGGTATTGGGAAGAAGTGGAAGGAGATACTTGATGTCACCGACAAGATATCTTTCACTAACCATGATGATTCAAGAAG
AAGTCGATTTAGTGTCTGAAGAGAAGACGCAAGTGTGTTAAGACTGATGAAGATGCAATATGGCTATTTTCTTGCATTGTTTGAGC
CGTTTTTCCTTGCAACTCTACAAAGTTCTGTGTTTTACTAAAAGATATTTTTTCTTAATATTAAGTTCAGTCATATAAAATTACTT
TGAATTCATCAATTTTGTGCACCCTTTCATCATATAGTGCTTTGATTGTTAAATGCTAATTTGTTAAGTTACTGGGACATCTCAAA
AATACAATTGTTTTAGTTTTCCTAAAAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ADK94611 translation initiation factor eIF(iso)4E.c [Brassica rapa]9582e-101
ADK94609 translation initiation factor eIF(iso)4E.a [Brassica rapa]9025e-095
ADK94610 translation initiation factor eIF(iso)4E.b [Brassica rapa]8936e-094
BAJ34023 unnamed protein product [Thellungiella halophila]8489e-089
NP_198412 translation initiation factor 4E-2 [Arabidopsis thaliana]8282e-086

Swiss-Prot top hits (Blast detail)Scoree value
O04663 Eukaryotic translation initiation factor 4E-28289e-088
P48600 Eukaryotic translation initiation factor 4E-26811e-070
Q03389 Eukaryotic translation initiation factor 4E-26612e-068
O81482 Eukaryotic translation initiation factor 4E-26568e-068
O23252 Eukaryotic translation initiation factor 4E-15152e-051

TrEMBL top hits (Blast detail)Scoree value
D3UW28 Translation initiation factor eIF(Iso)4E7124e-073
Q4PZB3 Eukaryotic initiation factor 4E7124e-073
B9SQU9 Eukaryotic translation initiation factor 4e, putative7081e-072
B0F832 Eukaryotic initiation factor iso4E7071e-072
Q66WU1 Eukaryotic initiation factor iso4E7052e-072

Arabidopsis top hits (Blast detail)Scoree value
AT5G35620.1 LSP1 (LOSS OF SUSCEPTIBILITY TO POTYVIRUS 1); RNA 7-methylguanosine cap binding / RNA binding / translation initiation factor8296e-089
AT5G35620.2 LSP1 (LOSS OF SUSCEPTIBILITY TO POTYVIRUS 1); RNA 7-methylguanosine cap binding / RNA binding / translation initiation factor6721e-070
AT4G18040.1 EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap binding / protein binding / translation initiation factor5152e-052
AT1G29590.1 eukaryotic translation initiation factor 4E, putative / eIF-4E, putative / eIF4E, putative / mRNA cap-binding protein, putative4622e-046
AT1G29550.1 eukaryotic translation initiation factor 4E, putative / eIF-4E, putative / eIF4E, putative / mRNA cap-binding protein, putative4613e-046

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  5%
 
126  27%
 
74  18%
 
95  23%
 
64  18%
 
112  9%

Unigene MembersMember information