Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17479

FASTA Sequence
Unigene ID: UN17479Length: 2114  SNP
GATCGGTTCTGTTAGCTCGTAAGTGAGATATGGGAAGCACTCCTGCTGAGTTACCGTGCGAGGATGTCGCAGATAACAGATCCGGC
GTCGGAGGTGGTATCTCCGACGTGTACGGCGAGGATTTAGCTACCTTGGATCAGCTCGTCACTCCTTGGGTTACCTCCGTCGCTAG
TGGATACTCGTTGATGCGTGACCCAAGATACAACAAGGGACTTGCGTTCACTGATAAAGAGAGAGATGCTCATTACTTAACTGGTC
TTCTTCCCCCTGTTATCATTAGCCAGGAAGTTCAGGAGAGGAAGCTGATGCACAATCTCCGCCAGTACACAGTTCCTCTACAGCGT
TACATGGCCCTCATGGATCTGCAGGAAAGGAACGAGAGGTTGTTCTATAAGCTTTTGATTGACAACGTGGAGGAGTTGCTTCCAGT
TGTGTACACACCAACAGTTGGCGAGGCTTGCCAGAAGTATGGTAGCATTTTCAGGAAGCCACAAGGTCTTTACATCAGCTTGAAAG
AGAAGGGCAAGATTCTTGAAGTGTTGAAGAACTGGCCCCAGAGAGGGATTCAAGTTATCGTTGTTACTGATGGTGAGCGCATTCTC
GGTCTTGGTGATCTTGGTTGCCAGGGAATGGGAATTCCAGTGGGGAAGCTTTCTCTTTACACAGCTTTGGGAGGAATCCGTCCATC
AGCTTGCCTTCCAATCACCATAGATGTGGGTACAAACAACCAGAAGTTGCTGGATGATGAATTCTACATTGGCCTTAAACAGAGAA
GGGCAACTGGCCAGGAGTATTCAGACTTTCTGCATGAGTTCATGTGCGCTGTGAAGCAGAACTATGGAGAGAAAGTGTTGGTACAG
TTTGAAGATTTTGCAAACCACAATGCGTTTGACCTTCTGTCTAAGTACATGGATACTCATCTTGTCTTCAATGACGATATCCAGGG
TACTGCATCAGTGGTGCTTGCTGGGCTTATTGCCGCTCAGAAGGTGCTTGGTAAAAGCCTGGCTGACCATACCTTCTTGTTCTTGG
GTGCCGGAGAGGCTGGAACTGGTATTGCTGAGTTAATTGCTCTTAAAATTTCGAAAGAGACTGGAGCTCCCATCGAGGAGACCAGG
AAGAAGATTTGGCTTGTGGACTCCAAGGGACTGATCGTTAGCTCCCGCAAAGAGTCGCTTCAGCATTTCAAGCAGCCATGGGCGCA
TGAGTACGAACCTGTCAAGGACCTCATTGGTGCTGTGAATGCAATCAAACCAACTGTTCTCATTGGAACATCAGGTGTGGGTCAGA
CTTTCACAAAGGAAGTTGTTGAAGCCATGGCTACCAACAACGAGAAACCGTTGATTCTTGCTCTCTCAAACCCTACTTCTCAAGCT
GAGTGTACCGCTGAACAGGCTTACACATGGACCGAGGGTCGTGCAATCTTTGGTAGTGGAAGCCCGTTTGATCCCGTTGAGTACAA
CGGCAAAACTTACTTGCCTGGCCAGGCAAACAACTGTTACATTTTCCCGGGTCTGGGACTTGGTTTGATCATGTCCGGTGCAATTC
GTGTCCGTGATGACATGCTCCTCGCAGCTTCTGAAGCATTGGCAGCTCAAGTCACAGAGGAGAACTTCGCCAACGGTTTGATCTAC
CCACCATTCTCAAACATCAGAGAGATCTCTGCTAACATTGCAGCCAGTGTCGCCGCAACAACCTATGACCTCGGATTGGCGTCGAA
CCTGCCACGTGCAAAGGATCTGGTGAAGTTTGCAGAGAGCTGCATGTACAGCCCTGTCTACAGAAACTACCGTTAAAAAGAAGTGT
TGCTGAAGAAACCACCTGCAGATTCTTCTTGTATTCACAACCTTGTTGAGGCTTTGTATTAAGTGTTGTTTGTTTGTTTTCTACTT
TCTACTACACTATGATGCTTCGAGCACTCTGTCTTTTGTCTTTGCTTCTTTGTTTCTGGAATAATAAAAAAAAACCTTTGCTCCGT
CGACTCTTGAGAGAGAGACGAACCAGAGAAATGTTTAGATCCGTCGTAAGAACCGCCGCCGGCAATCTCAAGCTCAATCGGAGATC
TCTGATTCCAAACGACGCCGTTTCTCATTTCCCTCCCGCGGCAACAACAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002871486 NADP-malic enzyme 2 [Arabidopsis lyrata subsp. lyrata]29170.0
NP_196728 malate dehydrogenase (oxaloacetate-decarboxylating)(NADP+) [Arabidopsis thaliana]29030.0
NP_197960 malate dehydrogenase (oxaloacetate-decarboxylating)(NADP+) [Arabidopsis thaliana]27482e-308
XP_002514230 malic enzyme, putative [Ricinus communis]25358e-284
NP_001152396 LOC100286036 [Zea mays]25251e-282

Swiss-Prot top hits (Blast detail)Scoree value
P51615 NADP-dependent malic enzyme25103e-282
P12628 NADP-dependent malic enzyme24833e-279
P34105 NADP-dependent malic enzyme24484e-275
P36444 NADP-dependent malic enzyme, chloroplastic24386e-274
P37223 NADP-dependent malic enzyme23939e-269

TrEMBL top hits (Blast detail)Scoree value
Q9LYG3 Malic enzyme29030.0
Q9XGZ0 Malic enzyme27481e-308
B9RKI6 Malic enzyme25355e-284
B6UDG4 Malic enzyme25258e-283
B8A2V9 Malic enzyme25185e-282

Arabidopsis top hits (Blast detail)Scoree value
AT5G11670.1 ATNADP-ME2 (NADP-malic enzyme 2); malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+)/ malic enzyme/ oxidoreductase, acting on NADH or NADPH, NAD or NADP as acceptor29040.0
AT5G25880.1 ATNADP-ME3 (NADP-malic enzyme 3); malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+)/ malic enzyme/ oxidoreductase, acting on NADH or NADPH, NAD or NADP as acceptor27494e-311
AT2G19900.1 ATNADP-ME1 (NADP-malic enzyme 1); malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+)/ malic enzyme/ oxidoreductase, acting on NADH or NADPH, NAD or NADP as acceptor23831e-268
AT1G79750.1 ATNADP-ME4 (NADP-malic enzyme 4); malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+)/ malic enzyme/ oxidoreductase, acting on NADH or NADPH, NAD or NADP as acceptor23722e-267
AT2G13560.1 malate oxidoreductase, putative10999e-120

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
211  3%
 
89  28%
 
121  3%
 
116  19%
 
74  13%
 
66  19%
 
203  9%
 
181  3%
 
151  3%

Unigene MembersMember information