Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17559

FASTA Sequence
Unigene ID: UN17559Length: 1116 SSR 
GGGTGTGACAGAGTGTTGCGCTGTTGTTGTTGTTCCTTCCCCCTCATTGGAGAGAAGCAAGCGAGCGAGTCTCTTACAATCCCAGA
GAGAGAGAGAGAGGCGTTTGTTCTTCCTCTAAGCCAAGAGTCTCAGTTGGGTGGCAAAGATGGTCGCAGAACGCTTCACTGTCGAT
TTGGATAAGCCACTTGTCTTTCAGGTTGGTCATCTTGGGGAAGAATATCAGGAATGGATTCATCAACCTATTGTATGCGTAGAGGG
TCCTCGTTTTTTCCAGAGTGATTTTTGGGAGTTCTTGACTCGCACGGTTTGGTGGGCAATCCCAACTATCTGGCTTCCAGTTGTCT
GCTACGTTCTTTCAATCTCCGCGGCGAGGGGACTGACATTTCCCCAGATGGGTTTAATAGTTGCATTTGGCGTATTCACGTGGACA
TTGCTCGAGTACACACTTCATCGTTTCCTTTTCCACATAGAAACCAAGAGCTACTGGGCAAACACTGCACACTATCTTCTTCATGG
ATGCCATCACAAGCACCCACAAGACGGCCTTCGTCTTGTTTTCCCTCCCACCGCAACAGCAATCCTCTTGGTTCCACTATGGAAGC
TTCTGCACCTCATAGCTACTCCTGCTACAGCTCCTGCTATGCTTGGAGGCATTTTGTTTGGCTATGTGATGTATGATTGTACTCAT
TTCTATCTACACCACGGTCAACCTAAAGAACCAACCTTCAAGCATCTCAAGAAGTACCATCTGAACCACCACTTCAGATCCAGGAC
AAAGGATATGGAATCACTTCTTCTCTCTGGGATAGAGTCTTTGGAACACTTCCCGGTACAAAGGCTGCTCAGAAGAAGAAGCTCTA
AACCGGATATCGTTTTGCCATTTTCAGTGTGTCAAAAACTCACTTCTGATTCATCATGTGATTTTATGACTGTTTAACTGATGTTG
TATACGATCTATCACCATATTTTGAACATATCTAGTGGTGTGTGAACCGGTTTTATGGTGTGGTCATAGAAAATTAAAATCAAACT
GGTTTATTTGCTATTCAATTTGGTCTTTTAATCGACTGTTTATTTGGGTACATATCTACTAAATAAATACATTTGGTTTTGTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_193819 fatty acid hydroxylase 2 [Arabidopsis thaliana]11161e-119
XP_002867872 hypothetical protein ARALYDRAFT_914595 [Arabidopsis lyrata subsp. lyrata]11081e-118
XP_002300560 predicted protein [Populus trichocarpa]8892e-093
XP_002330558 predicted protein [Populus trichocarpa]8822e-092
XP_002523169 sphingolipid fatty acid alpha hydroxylase [Ricinus communis]8784e-092

Swiss-Prot top hits (Blast detail)Scoree value
Q03529 Ceramide very long chain fatty acid hydroxylase SCS74061e-038
O13846 Ceramide very long chain fatty acid hydroxylase-like protein C19G12.083531e-032
Q4R4P4 Fatty acid 2-hydroxylase2941e-025
Q2LAM0 Fatty acid 2-hydroxylase2931e-025
Q7L5A8 Fatty acid 2-hydroxylase2903e-025

TrEMBL top hits (Blast detail)Scoree value
Q9SUC5 AT4g20870/T13K14_3011168e-120
A9PAI4 Predicted protein8892e-093
B9N5R8 Predicted protein8821e-092
B9SB09 Sphingolipid fatty acid alpha hydroxylase8783e-092
B4F857 Putative uncharacterized protein8731e-091

Arabidopsis top hits (Blast detail)Scoree value
AT4G20870.1 FAH2 (FATTY ACID HYDROXYLASE 2); catalytic/ fatty acid alpha-hydroxylase11164e-122
AT2G34770.1 FAH1 (FATTY ACID HYDROXYLASE 1); catalytic/ fatty acid alpha-hydroxylase8531e-091

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  27%
 
101  7%
 
151  7%
 
123  20%
 
92  13%
 
191  7%
 
113  20%

Unigene MembersMember information