Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17569

FASTA Sequence
Unigene ID: UN17569Length: 1835 SSRSNP
ACTTAGTTACACGCTAAAAGAAACCTCCAAACTAATAAACTATGGTCCAACAATAATGAGGATTTGGAAGTATGTAACAACTTTGT
CCATTTCAAAACAGCGGGAGCAACTGTTTATTGCAAGAAACGAAACCATTTAAAGACTTACAAAATAGATTACAAAAACAAGGAAT
ATTCAACAAACATCACTGTAGTGCTGTTTATAACACAAGTCGTGTGATTCTTTTCAAATTTTAAAAGGACCTTGGCTTCATTACGA
TTGTGGAGTGGTGAAGGATGTGCAAGCTGAACTGTCCACCTTTCTCAGAAGTATCCACTTTAGACTGTCCTGGAGGAGGAAGAAGC
TCGAAGTTCTGAACCAACCTACCAATCGTGATTCCCAAAATAGGCAACGCCAATATAATCCCTGGACAGCTTCTTCGTCCAACACC
AAACGGCACATACCTAAAGTCATTGCCGTTGGCTTCCACGTGAGCCTCTTCTTCAAAGAACCTCTCGGGCCTAAACTCTTCAGGTT
TCTTCCAGCTCTCGGGGTTGTTAGCTAGCCACCAGGCATTGACCAAGATCTTGCTCTCCGCCGGGATGTCGTAGCCAGCGAGCTTA
GCGTCGTTGAGGTTCATGTGAGGGACGAGGAGAGGAATAGCCATTCTTAGACGAAGTGTTTCCTTGATCACGGCTTGGAGGTATGG
AAGCTTGTGAAGCTCAGGCTCAGTGACTTGAACTCCTGGTCCAAGAACCGTGTCGATTTCGTTCCTTAGCTTGCTCTGGATCTCAG
GATGGTTCACTAGCTCCGCAATTCCCCATTCGATGGACCACAATGTTGTCTCAATAGCGGCGACGTTAATGTTCTCAACGATGTAA
AGAACATTATCCTCGTTGATTTCTCCCTTCTGCTGAGCTTCAAGGATGTGATCAATAGCACATTTCAATCCTTCGCTTCCTGTAGG
CTTCGAACTCGCAATTTGCTTCCTCTCGTCAACAAAGTACTTCTTGAAGAGCGCGAGTCTCCTGTCTTTCACATCTTGACAGATCT
TCAAGTAGCCTCTAAGGAACGGCCTAAGGATAGGGATGAAATCTCCGTAGTTATACTCAAAGCTCTGAGCCAACCTGCTCCTCTCT
CCGTTCAAGGCTTTAAGCCTCAGAAACAGAGGATCATCCTCGCTATCAAACCTCCTATCGAACATGATACGGAACATGTTGTTGTA
CATCATCAGCTGCAACCGTTTCCTCAACACGATCCCTTTAGTTGCTGAGTCAGGATTCTTCTTCACGTCCTCGACCACGCTCGCGG
CCTCGAACTCCCAACCTTCTCTGTTCTGCTGAACCACCTTGTTGGTGAAGAAAGGAACCGTCATGATTCTCCTCATCTTGCGCCAG
TGCTCCCCGTAGACGGTGAACACCATGTCCTGTCCCTTGCCAGTGAAGATGTCGAAGACGACGTTCCTAGTCCGAGATCCGAACTC
GACTCCCTGCGTGTGGAGGACCTCCTTGGTTAGGTTGGGCGAGGAGACGACGACTAGGTTTCGCTGGCCCATCCTGAGGAGGAAGA
GGTCGCCGAATCTCTTAGCGTAGTCGACGAGGTTGCGGTGGTTTAGGTCGTCTCCGACTTGGAGCCAGTTTCCGAAGATTGGGATC
GGCATAGGACCGGGAGGGAGTTTCAGTTTCTTGCCGCGGAGCTTGGAGATTACGGTGGCGACGACCACCGCCGCGAAGACGGCGAT
TAGTGACTTCTCCAGCAAGAGAAGATCCATTGCTTACAACTTCACTTCGCTCTCGGTTTCTAATTTTGTTATTACAGTGATTGATT
GATTGATTGATTTCAGGCAAATGTGAGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAI77480 cinnamate-4-hydroxylase [Brassica rapa]26136e-293
ABF17873 cinnamate 4-hydroxylase isoform 1 [Brassica napus]26111e-292
BAF81522 cinnamate-4-hydroxylase [Brassica rapa]26064e-292
BAI77481 cinnamate-4-hydroxylase [Brassica rapa]26021e-291
BAJ33716 unnamed protein product [Thellungiella halophila]26002e-291

Swiss-Prot top hits (Blast detail)Scoree value
P92994 Trans-cinnamate 4-monooxygenase25461e-286
P48522 Trans-cinnamate 4-monooxygenase23372e-262
Q43054 Trans-cinnamate 4-monooxygenase23231e-260
Q96423 Trans-cinnamate 4-monooxygenase23212e-260
P37115 Trans-cinnamate 4-monooxygenase23212e-260

TrEMBL top hits (Blast detail)Scoree value
D3KSN8 Cinnamate-4-hydroxylase26134e-293
A5GZU5 Cinnamate 4-hydroxylase isoform 126117e-293
A8CF55 Cinnamate-4-hydroxylase26063e-292
D3KSN7 Cinnamate-4-hydroxylase26063e-292
D3KSN9 Cinnamate-4-hydroxylase26027e-292

Arabidopsis top hits (Blast detail)Scoree value
AT2G30490.1 C4H (CINNAMATE-4-HYDROXYLASE); trans-cinnamate 4-monooxygenase25461e-287
AT2G40890.1 CYP98A3 (cytochrome P450, family 98, subfamily A, polypeptide 3); monooxygenase/ p-coumarate 3-hydroxylase6992e-073
AT4G22710.1 CYP706A2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding6311e-065
AT4G22690.1 CYP706A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding6222e-064
AT5G67310.1 CYP81G1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding5702e-058

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  10%
 
94  20%
 
182  10%
 
111  5%
 
102  10%
 
61  5%
 
81  5%
 
203  15%
 
214  20%

Unigene MembersMember information