Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17632

FASTA Sequence
Unigene ID: UN17632Length: 1250 SSRSNP
GGAAGACATCATTCGATGGCATTTCTCTGTTCTTCTTCTTCTTCACCATCGCCAGCGATGCAGAAAGGAGTTTTCGTGAGCGTGCC
TATACTTGTCCTCTCCCTCTCATTCGCAGCTGCCGTCTTCTTCCTCCTCTCCTCTTCTCTCTCCACCTCCTCCTGCTCCTGTCCTC
CATCTGCATCTTCTTCTCCGACCGTCGTTAGTGACGTGAGATTACAAGAGAAGATATCCCCGACGCGAGATGATATAGAGTGGGTC
AGAGATCTGATTAGATCCAATGGTTTGCATATGCAGAAGAACGAGCTCAGGAAGGGGATTAATCCTCGCACTAGAGATCAACAACT
CGCAGATCTGAAACAGTACAAGGGTATATCTCATTACGAAGGAGACAACAACCACACAGCTCTCCCATGCCCTGGTGAGTTACTAG
TCGAGCAGCATCACAGCAACTACGGCGAGCCATGGGCAGGTGGACGCGACGTATTCGAGTTCTTAGCCGAATCCTCCAATCTCAGA
CCAAACTCTCGCGTCCTCGAAATCGGGTGTGGCACCTTACGCGTGGGTCTGCATTTCATACGCTATCTCAACCCAAGTCACTTCCA
CTGCCTCGAAAAGGACGAGCTCTCTCTGATGGCTGCTTTGAGATACGAGCTCCCATCTCAAGGTCTTCTCCACAAACGTCCTCTTA
TACTCAGAGGAGAAGACATGGAGTTCAGCAAGTTCGGGTTAGATACAACGTATGATCTGATCTACGCGAGTGCTGTGTTCCTCCAC
ATGCCTGATAAGCTCGTGTGGACGGGACTCGAGAGGCTGGTTGAGAAGTTGAAGCCTTACGATGGGAGGATCTTCGTGTCGCATAA
CGTGAAGTTTTGCTCGAGGTTAGGTGGGGACGAGTGTGCGAAGAGGCTAGCGAGTTTGGGACTTGAGTATCTTGGCAAACAGACGC
ATGATAGCTTGCTGTTTAATCACTACGAGATCTGGTTCGGGTTTAGACGGTTTAGGACGTAAAAGATTGTTTGAAGTATCTGTTTT
CTTCACACGTCGTGAGGGATTTTAAAGAGTCCTAAGAGATTGTTTCTGTAGAGAAGATGTCAAGTGCAGAGATGACTGTATGTCTG
TATCTTACTTTTTTTGTGTTTATTACTTTATGGTGGGAGATCCGTGTATTGTTCATATAACAGCTGAGATTTCGAACCGAAACGAG
CCCCCGAACCAAAAATCTATATAGAATAGCAAACCATTTTTTTGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882393 hypothetical protein ARALYDRAFT_317378 [Arabidopsis lyrata subsp. lyrata]15282e-167
NP_187161 S-adenosylmethionine-dependent methyltransferase domain-containing protein [Arabidopsis thaliana]15041e-164
XP_002328526 predicted protein [Populus trichocarpa]12811e-138
XP_002512268 S-adenosylmethionine-dependent methyltransferase, putative [Ricinus communis]12721e-137
XP_002319611 predicted protein [Populus trichocarpa]12603e-136

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9MAA9 Putative uncharacterized protein At3g0510015049e-165
B9MZK0 Predicted protein12817e-139
B9REU9 S-adenosylmethionine-dependent methyltransferase, putative12728e-138
B9I895 Predicted protein12602e-136
C6TH26 Putative uncharacterized protein11411e-122

Arabidopsis top hits (Blast detail)Scoree value
AT3G05100.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 12 (InterPro:IPR013217); Has 53 Blast hits to 53 proteins in 21 species: Archae - 2; Bacteria - 27; Metazoa - 0; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).15054e-167

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  9%
 
94  17%
 
106  26%
 
81  4%
 
115  22%
 
202  9%
 
63  13%

Unigene MembersMember information