Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17648

FASTA Sequence
Unigene ID: UN17648Length: 1210 SSRSNP
GGGACTCACCACCACTCAATTCTAGCAAAAAACTCCATACCTATCTAGAGAGAGAGAGAAACTTAAGGTTTCTAGAGAGATGTCGA
AAGAAGTGAGCGAAGAGGGACACACTCAAAGCCATGGAAAAGACTACGTCGATCCTCCACCAGCTCCCTTTCTCGACATGGGTGAG
CTCAAGTCTTGGTCTTTCTACAGAGCCCTCATCGCCGAGTTCGTCGCCACCCTCCTCTTCCTCTACGTCACCATAGCCACCGTCAT
CGGCCACAAGAAGCAAACCGGTCCTTGCGACGGCGTCGGTTTACTCGGTATCGCTTGGGCTTTCGGTGGTATGATCTTCGTCCTCG
TTTACTGCACCGCCGGTATCTCTGGTGGTCACATCAACCCAGCTGTGACTTTCGGTCTGTTCTTGGCACGTAAGGTGTCTCTGGTG
AGAGCTGTTGGGTACATGATAGCTCAGTGTCTTGGAGCTATTTGTGGTGTGGGTTTCGTGAAGGCTTTCATGAAGACTCCTTACAA
CACTCTTGGAGGCGGAGCTAACACTGTGGCCCCTGGTTACAACAAAGGAACTGCTCTCGGAGCTGAGATCATTGGAACTTTCGTCC
TCGTTTACACCGTCTTCTCTGCCACTGACCCTAAGAGAAGCGCTCGTGACTCTCACATCCCTGTTTTGGCTCCACTTCCAATTGGA
TTCGCTGTGTTCATGGTGCATTTGGCTACTATCCCCATTACTGGAACTGGAATTAACCCAGCTAGAAGCTTTGGTGCTGCTGTTAT
CTACAACAACGAGAAGGCATGGGATGACCATTGGATCTTCTGGGTTGGTCCGTTCGTGGGAGCACTAGCAGCAGCAGCTTACCATC
AATACATTTTGAGAGCTGCAGCAGTTAAGGCCTTGGCCTCATTCAGAAGCAGTGCTACAAACTGATGATGAAGTGTGAATTTACCC
ACTTAGTGGAGGATTAAATGTTACTTTATTTGTTGCTTTTGTGTGTTATGAGAAAGAATTTAAGTTGGTGGATGGATGATGTTAAT
TATGAAATGAGTCTATGCTTTCTTTCTTTCCTTTATTGTTTTCGTTTAAAAGAAAAACCCACTTTGTTAGTTTTCAATAGTTTAGT
TTTGGTGTGTCTTGTGAATCATTTGGCTTATTATATCAGTTATCTTTTTATTTCTCACATCCGGTTCAAGACTATCATCACTTTTT
TTGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAG30607 aquaporin [Brassica oleracea]14637e-160
NP_195236 aquaporin PIP2-7 [Arabidopsis thaliana]13931e-151
XP_002869108 hypothetical protein ARALYDRAFT_491143 [Arabidopsis lyrata subsp. lyrata]13875e-151
AAB65787 plasma membrane intrinsic protein [Arabidopsis thaliana]13785e-150
AAB36949 plasma membrane intrinsic protein PIP3 [Arabidopsis thaliana]13785e-150

Swiss-Prot top hits (Blast detail)Scoree value
P93004 Aquaporin PIP2-713934e-153
Q9ZVX8 Probable aquaporin PIP2-813244e-145
P42767 Aquaporin PIP-type12886e-141
Q7XLR1 Probable aquaporin PIP2-611793e-128
Q9ATM4 Aquaporin PIP2-711409e-124

TrEMBL top hits (Blast detail)Scoree value
Q9FUC0 Aquaporin14635e-160
C0SVL5 Putative uncharacterized protein At4g35100 (Fragment)13937e-152
Q5DVT5 Plasma membrane intrinsic protein 2;513328e-145
A9PG56 Aquaporin, MIP family, PIP subfamily13174e-143
A1YS44 Aquaporin 213094e-142

Arabidopsis top hits (Blast detail)Scoree value
AT4G35100.1 PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3); water channel13943e-154
AT2G16850.1 PIP2;8 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;8); water channel13253e-146
AT5G60660.1 PIP2;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;4); water channel11362e-124
AT2G37170.1 PIP2B (PLASMA MEMBRANE INTRINSIC PROTEIN 2); water channel11263e-123
AT3G53420.1 PIP2A (PLASMA MEMBRANE INTRINSIC PROTEIN 2A); water channel11263e-123

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
714  29%
 
124  8%
 
68  17%
 
105  10%
 
181  2%
 
194  8%
 
202  4%
 
211  2%
 
95  10%
 
114  8%

Unigene MembersMember information