Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17653

FASTA Sequence
Unigene ID: UN17653Length: 951 SSR 
AGAAGACTTAAGTGTAGTTTAGAAAATTTTGTGAAATTAAACTCTTATGTTTTGTTTTATTATCAAATTTGGTGTTTTGAATTGGA
GTCATTGGGAAAACAGCAATGAGAACAATAAAGGAAGGTCATGAATTGTTGTTTTGTAAAGATCCAGAAGAGGAAGAAGACAAGGA
TCAAGCAGCTTTGAGGAACTTCAAGGTCTCATCAATGTGTTTCTCAGGCTGGAACTGGTTGTTGTAGATGAGCTGAACGACACCGT
TTTTGTCAAGAACATAAGTCTGCCTCCCTGGCAATGCCCCAAACAGATCTCCAGGCACTCCCCAATCTTTCCTCACCTTATTCCCT
TCGTCACTCAACAATGTGTATGGAAGCTTGTATTTGCTTGCAAAAGCCTTGTGAGAAGCAGAATCATCACCACTTATGCCAATGAC
CTCTGCGCCGGCCTTCTTGAATTTCTCATAAGAGTCTCTGAACGCACAAGCCTGCTTGGTGCAGCCAGGGGTTTCATCTGCAGGGT
AGAAATATAGAACAACAGGTTTCCCTTTATACTTCTTCAGGCTCACCGGCTTTCCGTTTTGATCCTTTAGCGTGAAGTCTGGTGCA
GTCTGCCCCTTGTTAACCTTCGCAGAGATTGAGCTTTTGAAAGAACAAGGAGAATAGAGGGGAGAGAGAGAGGTGGAGGGAGAGAG
TCTGAGACCAAAGAAGTTAGATTCTGATGACTTTGTGGGAACTGGAAACTGGGTTTTGGTGAGAATGGTGTTTCTGTGATGAAGAG
AGTGCAGTGTGGCCTGACTAGAGAAAGTTAAAAATGTAGAACAAGAAGAAGAAGAAGCCATGTCTGTTTTGTTCTCTCTATCAAAG
ACGTCTGCCACTAGGTTCACGCACTTCCTTCAAGTAATAGTAATTGTGAAATGGAAGTAGATGATGAAGATAGGGAAAGATTGGTG
CCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002875301 hypothetical protein ARALYDRAFT_484368 [Arabidopsis lyrata subsp. lyrata]9393e-099
NP_189235 peroxiredoxin Q [Arabidopsis thaliana]9251e-097
NP_001189979 peroxiredoxin Q [Arabidopsis thaliana]9133e-096
Q6UBI3 RecName: Full=Peroxiredoxin Q, chloroplastic; AltName: Full=Thioredoxin reductase; Flags: Precursor7762e-080
XP_002326305 peroxiredoxin [Populus trichocarpa]7682e-079

Swiss-Prot top hits (Blast detail)Scoree value
Q9LU86 Peroxiredoxin Q, chloroplastic9255e-099
Q6UBI3 Peroxiredoxin Q, chloroplastic7761e-081
Q6QPJ6 Peroxiredoxin Q, chloroplastic7661e-080
Q9MB35 Peroxiredoxin Q, chloroplastic (Fragment)7365e-077
Q75SY5 Peroxiredoxin Q, chloroplastic7177e-075

TrEMBL top hits (Blast detail)Scoree value
B9MT31 Peroxiredoxin7681e-079
A9PJX8 Putative uncharacterized protein7662e-079
B9RR55 Bacterioferritin comigratory protein, putative7582e-078
A9PAI3 Peroxiredoxin7563e-078
C6T293 Putative uncharacterized protein7502e-077

Arabidopsis top hits (Blast detail)Scoree value
AT3G26060.1 ATPRX Q; antioxidant/ peroxiredoxin9264e-100

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
72  11%
 
1211  58%
 
91  5%
 
62  11%
 
181  5%
 
111  5%
 
191  5%

Unigene MembersMember information