Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17723

FASTA Sequence
Unigene ID: UN17723Length: 1411  SNP
GGGCTAGACCAAAACTAATTCTCAATATCAAGAAAAAAATACATAAAGAGAGATAAACGACGGTGGTTGCTTCGCCGGAAATCTCG
CCGGAGCTCGAACTCTCGATTTCTTCTCCCATTTTCGTCCCGGCGAGGTCCGAGAGGGAGGTAACAATCATGCAGAAACGGAGAGC
GGTGAGGGAATCTTCCAAGACAACAACGTCAAGAGATGAAAAGGCTTTGGATTCATGTGAGAAGAAGAGATCTGAGAAGAGATTGA
TGAAGTTCGAGGAGTTGCCGAGGTATCTCAAAGACAACGAGTACATACACAATCATTACCGATGTGAATGGTCTCTCAAGGAGACT
TTCCTCAGCGCTTTCTCATGGCACAACGAGACTCTCAACATCTGGACGCACTTAGGTGGGTTTCTGATATTCGGGTGGATGATGGT
GGTGAGCTCCATGGAAACCACGGAGCTCGGCCTCGCCGGATTTGTCAGCGCCTTCTCCGGAGTAACAATTCGCTGGCCGTGGTCGT
CAATGGCTAAAGCCGTTTACTTCTTCTCCAGCGATCATCACGACTCGAACGTGACACACACTAGCTCGTTCTTGAACACACAAGGA
GAAGTTAACTACGAAACAATTCCCAAATGGCCATGGCTAGTCTTCTTAACCGGAGCAATGACCTGCTTGATATGCAGCTCCATGTC
ACATCTCTTCGCCTGCCACTCCAGACGTTTCAACCTCTTCTTCTGGCGCCTAGACTACGCAGGAATCTCCCTCATGATCGTCTGCT
CCTTCTTCGCACCAATCTACTACGCGTTCTCTTGCCACACTAACTGGCGTCTCTTCTACCTCTCCTCGATCTCAATCCTCGGCCTC
CTCGCCATCTTTGCTCTCCTCTCTCCAGCGCTCTCAGCTCCGCGTTTCAGATCTTTCAGAGCAGCTCTTTTCCTAACGATGGGATT
CTCAGGCGTCATACCCGCTTCGCACGTGCTTTACCTTCACTGGGATCATCCCAACGTGCGTTATCGCTCTTGGTTACGAGCTAGCG
ATGGCTGTGTTGTATGCAACGGGGGCAGGGTTTTACGTTAGCCGTATACCTGAGAGATGGAAGCCTGGTGCTTTCGATATTGCGGG
ACATAGCCATCAGATATTCCATGTGTTTGTAGTGTTAGGAGCCCTTGCTCATAGTGTTGCCTCTCTTCTTATCATGGATTTTCGAC
GTGCTTCGCCTTCTTGTGCCTTTTGAAGCAAGTAACAGAACTGTAAAACGTTTAGTGATATTTCATTCAACGTATCATAATGTATG
TGTTACATAGAAGATACGCATTGGCAATGTACTACACAACCCAAAATATTAAACGCTTATTCTGGTGGCAAATTGGTCACAGCTTA
AATAGTTTTTTAGAATCTGATTTATCATTTATGCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_194814 heptahelical transmembrane protein2 [Arabidopsis thaliana]12891e-139
AAL67024 unknown protein [Arabidopsis thaliana]12863e-139
XP_002867326 hypothetical protein ARALYDRAFT_491666 [Arabidopsis lyrata subsp. lyrata]12863e-139
BAJ34357 unnamed protein product [Thellungiella halophila]10122e-107
XP_002324517 predicted protein [Populus trichocarpa]8161e-084

Swiss-Prot top hits (Blast detail)Scoree value
Q9VCY8 ADIPOR-like receptor CG53152421e-019
Q94177 ADIPOR-like receptor C43G2.12304e-018
Q03419 ADIPOR-like receptor IZH11848e-013
Q6TCG8 Progestin and adipoQ receptor family member 31848e-013
Q6TCH7 Progestin and adipoQ receptor family member 31831e-012

TrEMBL top hits (Blast detail)Scoree value
Q84N34 At4g3085012899e-140
Q8VXZ4 Putative uncharacterized protein At4g3085012862e-139
B9IM94 Predicted protein8167e-085
A5BLW0 Putative uncharacterized protein8131e-084
C6T7N3 Putative uncharacterized protein6974e-071

Arabidopsis top hits (Blast detail)Scoree value
AT4G30850.1 HHP2 (HEPTAHELICAL TRANSMEMBRANE PROTEIN2); receptor12895e-142
AT4G30850.2 HHP2 (HEPTAHELICAL TRANSMEMBRANE PROTEIN2); receptor12895e-142
AT2G24150.1 HHP3 (heptahelical protein 3); receptor6174e-064
AT5G20270.1 HHP1 (HEPTAHELICAL TRANSMEMBRANE PROTEIN1); receptor3863e-037
AT4G37680.1 HHP4 (heptahelical protein 4); receptor3262e-030

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  17%
 
91  8%
 
61  8%
 
114  33%
 
122  17%
 
72  17%

Unigene MembersMember information