Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17750

FASTA Sequence
Unigene ID: UN17750Length: 1305  SNP
TTTCTCTCATCTCTCTTCTCATTCATCTCAGAGTATTACTTTGATCATTTCACATTCTCATAAAACCTAGCAAACGTTTTCTTGAT
AATAACTATGGCCGAAGAAACCAAGAACGTGGTTCATGAGCAAGATGTGCCAAAGGTAACGACCGAGGAATCATCAGCCGATGTTA
CGGATCGTGGACTGTTCGATTTCTTGGGGAAGAAGAAGGAGGAAACAAAACCAGAGGGGACCATCGACTCTGAGTTTGAACATAAG
GTTCATATCTCAGAACCGGTGGTGCCTGAGGTTAAACACGAGGAAGAAGAGAAGAAGCATAGTCTCCTCGAGAAGCTTCACCGAAG
CGACAGCTCTTCTAGCTCCTCAAGCGAGGAAGAAGGTGAAGATGGTGTGAAGAGGAAGAAGAAGAAGGACAAGAAGAAGACTACTA
CTTCTACAACTGTTGAAGGAGAGGTGAAAACTGACGAGGAGAAGAAAGGGTTTATGGACAAGCTGAAGGAGAAGCTTCCAGGACAC
GGAAAGAAGCCTGAAGATGCCTCACCCGCCGCCCCTGCCGCACCGGTTGTTGCTCCTCCGGTGGAGGAAGCGCATCCGGCGGAGAA
GAAGGGGATCTTGGAGAAGATCAAGGAGAAGCTCCCAGGGTACCATCCCAAGACCGTAGATGAGGTGAAGAAGGAAAAGGAATCTG
ATTAATGATGATGGTGTGTTTTTGTGATGAGTGGTGATCATCCTTTTGCTTTTGTGTTGTTTTAAGTTTGTTGGCTTTTATGTTGT
TCCTTTTTTTTCAGTTTCCCTATTATTCTGTCTTTGTTATGTTTTGTATATGATATCAAGATGTTTTAATGTTATAAATGTTTTTT
TTTTTGAAAAAAAACTTTCTTCTTCTCTTGTTCTTCACCTCTCCTTCAGTAGTTACCTTCTTCTTGTCCTTCTTCTTCTTCCTCTT
CACACCATCTTCCCCTTCTTCCTCGCTTGAGGAGCTTGAAGAGCTGTCGCTGCGGTGAAGCTTCTCGAGGAGACTATGATGCTTCT
TCTCTTCTTCTTCTTCCACGTGTTTAACCTCAGGCGCCGGCTCCGAGACGTGAACCTTTTGCTCAAACTCAGACGCTATGGCGGTC
TCCTCTGGTTTTGTTTCATCTTTCTTCTTCCCCAAGAAATCGAACAGTCCACGATCTGTGACCTCTGTGGCCGCTGCTGATGATTC
CTCCGACTCTACCTTTGGCACCTCAACGTTCTTGGTTTCCTCTGCCATAGTTATCGGGAAAAGTTTTGTTTGCTCTGCTGATGAGA
ATACGAAACGATCAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABD95987 dehydrin [Brassica juncea]9621e-101
CAA64428 pollen coat protein [Brassica oleracea]8015e-083
ABV89609 pollen coat protein [Brassica rapa]6188e-062
ABV56004 dehydrin protein [Capsella bursa-pastoris]5552e-054
AAO48424 cold-regulated protein Cor25 [Brassica rapa subsp. pekinensis]4843e-046

Swiss-Prot top hits (Blast detail)Scoree value
P42763 Dehydrin ERD146766e-070
Q9XJ56 Phosphoprotein ECPP444052e-038
P31168 Dehydrin COR473854e-036
P42759 Dehydrin ERD102913e-025
P46524 Dehydrin COR4102331e-018

TrEMBL top hits (Blast detail)Scoree value
A9X5B5 Dehydrin9627e-102
Q39386 Pollen coat protein8013e-083
A8IXD7 Pollen coat protein7881e-081
C6EQ93 Dehydrin protein5551e-054
Q7XB29 Cold-regulated protein Cor254842e-046

Arabidopsis top hits (Blast detail)Scoree value
AT1G76180.1 ERD14 (EARLY RESPONSE TO DEHYDRATION 14); calcium ion binding6766e-071
AT1G20440.1 COR47 (COLD-REGULATED 47)3853e-037
AT1G20450.1 ERD10 (EARLY RESPONSIVE TO DEHYDRATION 10); actin binding2912e-026
AT1G20450.2 ERD10 (EARLY RESPONSIVE TO DEHYDRATION 10); actin binding2634e-023
AT2G21490.1 LEA (DEHYDRIN LEA)1319e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
204  12%
 
62  6%
 
77  21%
 
116  18%
 
123  9%
 
96  18%
 
104  12%
 
212  6%

Unigene MembersMember information