Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17786

FASTA Sequence
Unigene ID: UN17786Length: 1314  SNP
GCTGTAAAGATGATTAGATTATGGTTTACATTAATCTGGTTTAAGACAATGCCTTTATCTTTGCTATATAAAGAGTGATATAACAC
TTGGGAAATTAAAGAGCCAAGACTAACAAAACAACTCGAAGTTCGAAACATATTCAAACTAGAAAGACAATAGCACAAATCTGAAA
TGGACAAAATCAAGAAAACACAAGTCATCATACTACAAACGAAGCAGCACTTATAGCAACGACAAAAAAGGTGGAACTCGGGAGAG
ATATAACAAATGGATCTACTCATCACCGAACATATCGAAACCACCGTAGTCTTCTTCATCTGATTCCTCAACCACTTCCTTCTTCT
CCTCTACCTTGGCAGCTCCAGCCGAAGCCCCACCACCTGCATCGGCAGATACAGCCGCTGCAGCAACAGCGAACTTGCTAGGATCC
TTCAAGTACTCCTTGACCTTCTCTGCTTGTGGGAAAGTGTACTCGGTGGCAACTGAGATGGCCAATGCGTTCTTGTACGCATTGAT
GAACATATGCGGAGCAGCAGCAAGGGTAGGGTAAGAGATAGCTAGCGCCAAGGAAGTGACCATGGAGATACCAGCGGCAAACTTCT
GGACAAGGTCATCTTCCGTAAGATCGAGAACCTCTGGGCTGAAGACAGAGCCATTGTCGTAAACAGACTGGACAACAAGACCGTAC
GAGAACGGCCTGATGCCGAGCTTGGCTAGAAGGGCAGCCTCGGAAGAACCGACCTTGTCACCTTGCTTGATGAGCTCAACAGGGGT
GATGATTTCGACTGTTCCCTTGTTAATCTTAGTTGGGATGTTAAGAACCTGGAAGAAAGATGTCTGAGATGGATCGAGACCAGTGT
TACCAGGTTGGACAACCACATCAATTGGCGCAACCAAACCCACACGAGCAGGAGCACCAACCTTGTACTTGGCAACTTCCTCACTC
ACTTCCTTGAGGTCACCCTTGGTAAAGATCAAACCAACATTTCCCTGAAGGAGGGGCATGAGATTGAGGATTCCAGTGTTTCCAGT
GTTCTCAGCGTGAATCTTAACGGAACGCTTCATCATAGTGTTCTTGCCCATGAGGACAACTGAGTCACCACGAAGACCTTTCCTGA
TGTTCTGGAGCTGAGTCGACCCGACGTTGTCGGCTGCAACGACCAAGATCTGGGTGAACTCGTCGATGAGCTGACATAGCTTCGCG
TCGTAAGCGATCTTCTTCTCGGCCTTTGTTGCCTTCACCATTGTTGTTGCTCACGGGATGAGACTCGTTTTTTCCTCTTTGTCTGC
AGAAAGAGTGACGGAGATTACAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884720 60S acidic ribosomal protein P0 [Arabidopsis lyrata subsp. lyrata]14664e-160
XP_002882720 60S acidic ribosomal protein P0 [Arabidopsis lyrata subsp. lyrata]14655e-160
NP_187734 60S acidic ribosomal protein P0-3 [Arabidopsis thaliana]14611e-159
AAM65265 60S acidic ribosomal protein P0-C [Arabidopsis thaliana]14592e-159
NP_187531 60S acidic ribosomal protein P0-2 [Arabidopsis thaliana]14549e-159

Swiss-Prot top hits (Blast detail)Scoree value
P57691 60S acidic ribosomal protein P0-314616e-161
Q42112 60S acidic ribosomal protein P0-214544e-160
P50346 60S acidic ribosomal protein P013066e-143
O04204 60S acidic ribosomal protein P0-113022e-142
P41095 60S acidic ribosomal protein P012546e-137

TrEMBL top hits (Blast detail)Scoree value
B9SLK4 60S acidic ribosomal protein P0, putative13426e-146
B7FJF1 Putative uncharacterized protein13418e-146
B9HSR0 Predicted protein13337e-145
A9PF35 Putative uncharacterized protein13273e-144
B9HHM2 Predicted protein13193e-143

Arabidopsis top hits (Blast detail)Scoree value
AT3G11250.1 60S acidic ribosomal protein P0 (RPP0C)14624e-162
AT3G09200.1 60S acidic ribosomal protein P0 (RPP0B)14543e-161
AT2G40010.1 60S acidic ribosomal protein P0 (RPP0A)13021e-143
AT3G09200.2 60S acidic ribosomal protein P0 (RPP0B)11587e-127

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  10%
 
99  23%
 
65  13%
 
74  10%
 
115  13%
 
87  18%
 
192  5%
 
201  3%
 
181  3%
 
121  3%

Unigene MembersMember information