Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17811

FASTA Sequence
Unigene ID: UN17811Length: 1307  SNP
TTTTTTAAAATATTAATTCAACAAATATCGACATTCTCCTCTTGGTTTATTGATCGGGATCGGTCCGGATCTCAGACGCTTGTGAG
GCTCTTCAAATGGCGCAGCTACTCTCCCCAGTTTGCACGGATCTTTTGAAGTTTCAGAGCTCTCTTCTCAGCTCTAGATCGCGTTT
CTCAGCCAAAACAAGCGGTGCTACCTCGTCTTGGTGCTTACCTGCTTACACAGGAAGGAGACGAAGTGGCTCCATCGGAAGATTGA
GAGTTGCAACAGAGGACGCTTCTTCTCTTTCCACCGGCGACGTCGCCGATGATTACTATGCCGTTCTCGGACTGCTTCCGGATGCT
ACACCAGCGGAGATTAAGAAAGCATATTATAACTGTATGAAGTCTTGCCATCCTGACTTGAGTGGCAATGACCCTGAAACCACAAA
CTTCTGCATGTTCATTAACGATGTCTATGAGATTCTTAGTGACCCTGTACAGAGAATGGTTTACGATGAGATTCATGGGTATGCAG
TGACTGCTACCAATCCTTTTCTTGATGACTCTAGCCCTAAGGATCATGTTTTTGTTGATGAGTTTGCTTGTATAGGCTGCAAAAAC
TGTGCCAATGTGGCTCCAGATATATTTGAAATTGAGGAGGACTTTGGAAGAGCAAGGGCTTGTAACCAGCGTGGCAACCCTGATTT
GATTCAGCAAGCAGTTGAAACATGCCCGGTTGATTGTATCTATCAGACTTCTGCGGCACAGTTGTCTTTGCTTGAAGATGAAATGC
GTAGGGTTGAAAGAGTTAATGTTGCTCTGATGCTTTCTGGAATGGGGTCAGGAGCCGTTGATGTTTTCAGAATGGCGAGATCTCGA
TGGGAAAAAAGGCAAGCAAAAGTTTTGAATCAAGCTAGAAGTAGAATGATGAAGCGGAAAAGCACAGATGAAACACCTTCCTATTG
GGATAACCTCTGGGGCAAAGATAATCAATACCAGAAAAGCGAGGAAGAAGTACAAGAACGAGCTCAACGAGCCGCAGCAGCAGCCA
GAAGATGGAGGGAGTACTCACGAAGAGGCGTGGATAAACGCCCCACGTTCAAACTCCCTGACTCCTCATCCTCCAGAGGAGACAAC
TGAAACCACCCTCCAGACATGAATCTTAATGGTAGTAAAGTATATATGTAATAACTTCACCGTTCCTAGACTTGTATAGCTTTCTT
CCCATATCGATTTGTGGAAGAATAAAAACAAGTGTATTAAACGTTTTCATTTTCATGTATTATATACTCTTTATGTATATAAGTCT
CTCTCCAAGGCCTAGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880004 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis lyrata subsp. lyrata]16601e-182
NP_565982 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis thaliana]16483e-181
ACU18106 unknown [Glycine max]12227e-132
ACJ84986 unknown [Medicago truncatula]12201e-131
XP_002530203 expressed protein, putative [Ricinus communis]11968e-129

Swiss-Prot top hits (Blast detail)Scoree value
Q3AF07 Chaperone protein dnaJ1613e-010
Q8GYX8 Chaperone protein dnaJ 101596e-010
Q67S53 Chaperone protein dnaJ1561e-009
B9MJZ0 Chaperone protein dnaJ1542e-009
B8CXL0 Chaperone protein dnaJ1506e-009

TrEMBL top hits (Blast detail)Scoree value
Q9SJI1 At2g42750/F7D19.2516482e-181
C6T8F4 Putative uncharacterized protein12225e-132
B7FJQ7 Putative uncharacterized protein12209e-132
B9SW34 Expressed protein, putative11965e-129
B9IA58 Predicted protein11697e-126

Arabidopsis top hits (Blast detail)Scoree value
AT2G42750.1 DNAJ heat shock N-terminal domain-containing protein16552e-184
AT5G23240.1 DNAJ heat shock N-terminal domain-containing protein2832e-025
AT1G21080.1 DNAJ heat shock N-terminal domain-containing protein1632e-011
AT1G76700.1 DNAJ heat shock N-terminal domain-containing protein1595e-011
AT5G48030.1 GFA2 (GAMETOPHYTIC FACTOR 2); heat shock protein binding / unfolded protein binding1587e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  36%
 
91  9%
 
82  18%
 
201  9%
 
121  9%
 
72  18%

Unigene MembersMember information