Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17829

FASTA Sequence
Unigene ID: UN17829Length: 1074  SNP
GGCGGTCTCAAACCCTAATTGTAGTCTTCGCCGTCTAGCATCCATCCATCCATGGGTCGTGTCATCAGAGCCCAACGTAAGGGAGC
TGGTTCCGTCTTCAAGTCCCACACCCACCACCGCAAGGGTCCAGCCAAGTTCCGCAGCCTCGACTACGGCGAGAGAAATGGATACC
TCAAGGGCGTCGTGACGGAGATCATCCACGATCCCGGCCGTGGTGCGCCGCTAGCTCGCGTCGCGTTCCGTCATCCTTTCCGTTAC
AAGAAGCAGAAGGAGCTCTTCGTCGCCGCCGAGGGTATGTACACGGGACAGTTCTTGTACTGCGGTAAGAAAGCCACTCTCGTTGT
CGGAAATGTTCTCCCCCTTAGAGCTATTCCTGAAGGAGCTGTTGTCTGTAACGTCGAGCATCATGTCGGTGATCGTGGTGTGCTCG
CTAGAGCTTCTGGTGATTACGCTATCGTTATTTCACACAACCCTGACAACGACACTACTAGGGTCAAGTTGCCATCTGGTTCGAAG
AAGATTGTTCCGAGTGGATGCAGGGCCATGATTGGTCAAGTTGCAGGTGGTGGAAGGACCGAGAAGCCGATGCTCAAGGCAGGAAA
CGCGTACCACAAGTACCGTGTGAAGAGGAACTCATGGCCTAAGGTTCGTGGTGTGGCTATGAATCCAGTGGAGCATCCCCATGGAG
GAGGTAACCATCAGCACATTGGTCACGCCAGTACTGTTAGACGTGATGCACCTCCTGGACAGAAGGTTGGTCTTATTGCTGCTAGG
AGAACTGGTCGTCTCAGAGGTCAAGCTGCTGCTTCTGCTGCCAAGGCCGACTAGGTTTCATAAGATATTTTTGTTTGCGTTTTGCT
GTCTTTCCTTTCGGACCTTGTTGTGTTCTGAAATCTCAAAAATATTTTGTTATAATCTTGTCCTTCTCTGTCGAAGTTATTATTAT
GTCTTTACAATTTTCATTTCGCAAGTGTTGATTATATTTGTTCATTTTTCGTTTTGTTCTCTAATTAAACTACATATATTTCTGGT
CGAAGTTGGGATGCTAATTGAATCTTGGTCTTTTTGTAACGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884102 predicted protein [Arabidopsis lyrata subsp. lyrata]13462e-146
NP_179393 60S ribosomal protein L8-1 [Arabidopsis thaliana]13419e-146
XP_002869043 60S ribosomal protein L8 [Arabidopsis lyrata subsp. lyrata]13283e-144
NP_195336 60S ribosomal protein L8-3 [Arabidopsis thaliana]13231e-143
XP_002310303 predicted protein [Populus trichocarpa]13212e-143

Swiss-Prot top hits (Blast detail)Scoree value
P46286 60S ribosomal protein L8-113414e-147
Q42064 60S ribosomal protein L8-313235e-145
P29766 60S ribosomal protein L812941e-141
P25998 60S ribosomal protein L812671e-138
Q4PSL7 60S ribosomal protein L8-212025e-131

TrEMBL top hits (Blast detail)Scoree value
A9PBZ5 Predicted protein13211e-143
A9PCT0 Predicted protein13165e-143
C6T5K7 Putative uncharacterized protein (Fragment)13121e-142
C6TDL5 Putative uncharacterized protein13059e-142
A5AW13 Putative uncharacterized protein13022e-141

Arabidopsis top hits (Blast detail)Scoree value
AT2G18020.1 EMB2296 (embryo defective 2296); structural constituent of ribosome13423e-148
AT4G36130.1 60S ribosomal protein L8 (RPL8C)13243e-146
AT3G51190.1 structural constituent of ribosome12043e-132
ATCG00830.1 encodes a chloroplast ribosomal protein L2, a constituent of the large subunit of the ribosomal complex2518e-022
ATCG01310.1 encodes a chloroplast ribosomal protein L2, a constituent of the large subunit of the ribosomal complex2518e-022

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  27%
 
64  27%
 
182  13%
 
72  13%
 
111  7%
 
92  13%

Unigene MembersMember information