Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17835

FASTA Sequence
Unigene ID: UN17835Length: 1608  SNP
GATTAAGAAAAGCTGCTGTCTTCATATAAAAAAGCCAGAGCTATCTCAAGTTTATCTTACAAAAATTAAAGCATCTTTCTTCCCAA
AAAGGGTTCAAACGATAAACAGGAAAAAACCAACAACGTAGCAAAAACTTAAAATGTTTTATTTAAGTAAAAGGAGCAAACACAAC
TCTGATCTTCTTCTTCTCGTCACAAAGAAACTGGCACTTTGTCTAGTAGGGCTCCACAGGTTTGCGGAAGTTAGCTCCAGCGTAAA
CTGCCTCTGATCCCAACTCCTCCTCAATACGCAAAAGCTGGTTGTACTTGGCAAGACGCTCGGACCTGCAAGGAGCTCCAGTCTTG
ATTTGTCCAGTAGACAAGCCAACAGCTAGGTCAGCGATGAAGGTGTCCTCGGTTTCACCACTTCTGTGGCTGGTCATCACTCCCCA
TCCTGCTTTCTTCGACATCCTCACTGCCTCAATACTCTCTGTCACTGACCCGATTTGGTTAACCTTCAAGAGAAGAGCATTGCAAG
ACTTCTCTGCGATTGCCTTCGCAACCCTCTTGGGGTTGGTGACCAACAAGTCATCACCGACAATCTGAACATTGTCTCCACACTCA
GCGGTCATCTTAGCGTAGTGCTCCCAGTCATCTTGGTCAAATGGATCCTCAATAGACACGATTGGGTACTCCGAAACAAAGGACTT
GTAGAGGTCCTTGAGTGCATCACCAGAAATCTTCTGAGAGCCATTGTTGTTCTCTTCCTTGAAATTCAAGTCGTAGGTCTTGTCTG
ATGAGTAGAACTCGGAAGCGGCAACATCCATTCCAATGACAACCTTGCCAGTGTAGCCAGCCTTTTCAATGGCGGTCTTGAGCAAT
TCAAGACCTTCCTTGTTCTCCTGAATGTTTGGTGCAAAGCCACCTTCATCACCAACGTTTGTAGCGTCCTGGCCGTACTTCTTCTT
AATCACAGACTTCAAGTTGTGGTAAACCTCAACACCCATTTTCATGGCTTCTTTGAAAGATGAAGCTCCGATAGGGAGAATCATAA
ACTCCTGCATAGCGAGCTTGTTTCCGGCATGTGATCCACCATTGATAACGTTGAAGGCAGGAACAGGTAGCACAATCTTAGGGTTA
CCAGCGAGATTGGCAATGTGCTTGTAGAGAGGAATGCCACTGACAACGGCCCCAGCCTTGCAGACAGCAAGAGACACAGCAAGGAT
AGCATTGGCTCCAAGCTTTTGTTTGCACCAACCCCACTCGTTCTGGGTGCCATCAAGTTCATGGACCATGAAGTTGTCAATAGCAG
TCTGCTGAGTTGGGTCCTTTCCAATCAATGCTGGGCCGATGATGTTGTTCACATTGCCAACAGCCTTAGAAACACCCTTTCCAAGG
TAGTCAGAGCCACCATCCCTAAGCTCAAGAGCCTCGTAGATACCAGTGGAAGCTCCACTAGGAACAGCTGCTGTAACCTTGACACC
AGTGGATGTGTGTACATCAACCTCGACGGTGGGGTTGCCACGGCTGTCGAAGATCTGCCTAGCTTTAACAACAGTGATAGTGGCCA
TGGTTGAGAGTAGATCTAGAGAAGAAGACAGGGGCGATGAGTACGAGGGTTTAGTGAGCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABD92697 los [Brassica rapa subsp. chinensis]22409e-250
AAQ77240 enolase [Brassica rapa subsp. campestris]22344e-249
AAS66001 LOS2 [Capsella bursa-pastoris]22327e-249
NP_181192 bifunctional enolase 2/transcriptional activator [Arabidopsis thaliana]22301e-248
AAQ77241 enolase [Brassica napus]22273e-248

Swiss-Prot top hits (Blast detail)Scoree value
P25696 Enolase22305e-250
P26300 Enolase20853e-233
P42896 Enolase20397e-228
Q9LEJ0 Enolase 120352e-227
Q43130 Enolase20352e-227

TrEMBL top hits (Blast detail)Scoree value
Q20D56 Enolase22406e-250
Q6W7E8 Enolase22343e-249
Q6Q4Z3 Enolase22325e-249
Q6W7E7 Enolase22272e-248
Q8VYG4 Enolase22253e-248

Arabidopsis top hits (Blast detail)Scoree value
AT2G36530.1 LOS2; copper ion binding / phosphopyruvate hydratase22314e-251
AT1G74030.1 enolase, putative14742e-163
AT2G29560.1 enolase, putative12376e-136

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
93  16%
 
83  16%
 
194  21%
 
202  11%
 
181  5%
 
216  32%

Unigene MembersMember information