Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17859

FASTA Sequence
Unigene ID: UN17859Length: 822  SNP
TTTTTTTTTCGAGCAAGAAACTGGAACTATAAAATAGGTTTCAAAATTGAAAAGTACAGACACAAGTCTTTGTGAAATGTAACATT
AAAGATTGTGAATACCACAACATATAAATTCAAAACCTCACTTCTCTATCTTGATGATGATTCTTCAGAGCATCATCCATCATCAA
GCTTCCACCGGGTACTCAAAAGTGACATCCTTTCCAGTAAGTTTGCGGTACACTCCCACCATAGTCTCGAGCTTGTACTCTGTGTT
GTTCCTTTCCTTGGCCTCCAAATACACCTTCATGACTTTGGATCCATCGAGACGGTAACGAGTACGTTTTCCAACGATCTCAGCAG
GGTAAGCCACGTCCTCGAGCATAGCTTCATGAACAGAGGTTAGAGTCCTGTTGCGTGGCCTCTGAACAGCAGCACCCTTCTTTGGT
GGACGCATGATCCTTCTTGTGGCAACAAAGATAACATCCTTTCCACTGAACTTCTTCTCAAGCTCTCTAACGAGACGGGGGTGGAT
CTTGCGGAAAGCTTTCCTCAATCTGAACGGGACGTAAATCACAATAGCCTTGCGGTTTCCAGAGATGTCCATGTTAACAGCTTGGT
TGATGTAAAGATCTTTCAACTCGCTTTTCAACTCCTGGTTAGTGTTCTCTAAATCAAACAAAGCCTGAGCAACTTGCACATCGCAT
TCTGTCGGCTCGGCATTCTTGTCCTTCTTGATCTTGTTCTGAGCGGAGAACATCTTCACAGAATCGGTTGACGAAATCTGCAAGGA
TGAAGAAGCGTCTGTCTAGAGAGGTTTTGCGGCTTCTTCTTACAAGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197117 40S ribosomal protein S7-3 [Arabidopsis thaliana]9232e-097
XP_002871704 40S ribosomal protein S7 [Arabidopsis lyrata subsp. lyrata]9222e-097
AAM64364 40S ribosomal protein S7-like [Arabidopsis thaliana]9186e-097
Q9XH45 RecName: Full=40S ribosomal protein S78586e-090
ABD96919 hypothetical protein [Cleome spinosa]8514e-089

Swiss-Prot top hits (Blast detail)Scoree value
Q8LD03 40S ribosomal protein S7-39238e-099
Q9XH45 40S ribosomal protein S78583e-091
Q9M885 40S ribosomal protein S7-28458e-090
Q9C514 40S ribosomal protein S7-17534e-079
Q9ZNS1 40S ribosomal protein S77491e-078

TrEMBL top hits (Blast detail)Scoree value
Q1KUR6 Putative uncharacterized protein8513e-089
Q1KUM0 Putative uncharacterized protein8226e-086
C6T2H2 Putative uncharacterized protein8012e-083
B9HBT7 Predicted protein (Fragment)7869e-082
C6SV96 Putative uncharacterized protein7841e-081

Arabidopsis top hits (Blast detail)Scoree value
AT5G16130.1 40S ribosomal protein S7 (RPS7C)9245e-100
AT3G02560.1 40S ribosomal protein S7 (RPS7B)8458e-091
AT3G02560.2 40S ribosomal protein S7 (RPS7B)8458e-091
AT1G48830.1 40S ribosomal protein S7 (RPS7A)7534e-080
AT1G48830.2 40S ribosomal protein S7 (RPS7A)7534e-080

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  12%
 
117  16%
 
811  26%
 
62  5%
 
75  12%
 
127  16%
 
95  12%
 
11  2%

Unigene MembersMember information