Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN17872

FASTA Sequence
Unigene ID: UN17872Length: 1130  SNP
ATCTGAAAGAATAAATAACTATCATTTTCATAAAAAATATTTTCCAAAAAAATACATTGACATCTTAACATTTATAAATATATAGG
CACACCTTTAATTTGCTTTATTGGACAAAGATATACAATCGAAAGAATCGAACACAATTGACAAAAGAGGAAGGAGAGCATTATAC
ATATAGAAGAGAAAGAAAGCAGAGGAGGAGGATAAATAGATAAAATGTATATGATCCCTCTATGACCTTGTTGCACATTCCCGAGG
GATTCCCTGTGGAAACCTCTTAGTATCCGTACAGTAATTGTAGATCATGTAGTTCTTCTGAACCCATCTGAGTCTAGCTTGGCTCG
TTGAATCCATTTCTTGAGTGTACCAATTAGAGCTTGGTTTCGTCGTGGTACAAGACGATCTTCCGTTTGAATGAGCACACCCGTCG
ATCTTAATGTTCCTGTAAGAAGCAGTGAATGGAGCTTTGGACCAATCCGTTTTAACCAGACCGCCTCTAGTTGCCCAATCGTCTGC
GTTCCATAAACTTGCGTACATCCTCATCGGCTTGCTCTTTGGAAACAAGACACCGAGAGACTCCGAGTTCTTAAACTCTCTAATTG
GCGTGTTATCGACGGTTAATATGATTCTTTGAGGGTTCCAGAGGATTGAGTAAGTGTGGAAATTTGCTGTTGGGTCGAACCAGAGA
TGGAACTGTTGCTCTTTATCACCTTTACCTTGAGTGTAAACATTGGTGTGTAGAGTATAAGGATCTCCACTCATGTTACCCAAGAA
CTCAAAATCAATCTCATCCCAGGTCGTTCCTTCCGATTTCAAATAGAAAGTTGTGACTGTGCCTGCTGAGTTACCAGGAACAAGCT
TAATCTGCATATCAATCTTACCAAACAAATACTCTGTTTTGGATTGAAAACCAGAACCAGATGATTTGTCTAAGGTGAGAGTAAGA
AGCTGGCCGTTGTTGAGTATCTTCCCACGGCCGTTTCCCCAAGCCACGTTGACGTCGCTGTTGAAGTCAGCGGTGGAGGCTGAAAA
CGCCGCCGCGAGGAGAGCTGTGAATAATAATATTTTGAAAGGAGACATTGTTGTGTGTGCGTACGTGTGGGTGTATGTGTTTGGAG
TTTGGTGAGGAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33741 unnamed protein product [Thellungiella halophila]14143e-154
XP_002866213 hypothetical protein ARALYDRAFT_918931 [Arabidopsis lyrata subsp. lyrata]11511e-123
NP_200564 xyloglucan endotransglucosylase/hydrolase protein 22 [Arabidopsis thaliana]11473e-123
BAJ34580 unnamed protein product [Thellungiella halophila]11473e-123
CAN80250 hypothetical protein VITISV_036640 [Vitis vinifera]11402e-122

Swiss-Prot top hits (Blast detail)Scoree value
Q38857 Xyloglucan endotransglucosylase/hydrolase protein 2211471e-124
P24806 Xyloglucan endotransglucosylase/hydrolase protein 2411121e-120
Q38910 Probable xyloglucan endotransglucosylase/hydrolase protein 2311013e-119
Q38907 Probable xyloglucan endotransglucosylase/hydrolase protein 2510718e-116
Q9FI31 Xyloglucan endotransglucosylase/hydrolase protein 2010252e-110

TrEMBL top hits (Blast detail)Scoree value
A5ANA9 Putative uncharacterized protein11401e-122
A5C3A3 Putative uncharacterized protein11339e-122
A5BND5 Putative uncharacterized protein (Fragment)11302e-121
Q84JX3 Putative xyloglucan endotransglycosylase11283e-121
B9SJR0 Putative uncharacterized protein11249e-121

Arabidopsis top hits (Blast detail)Scoree value
AT5G57560.1 TCH4 (Touch 4); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase11471e-125
AT4G30270.1 MERI5B (meristem-5); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase11121e-121
AT4G25810.1 XTR6 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 6); hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds / xyloglucan:xyloglucosyl transferase11012e-120
AT5G57550.1 XTR3 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 3); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase10717e-117
AT5G48070.1 XTH20 (XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 20); hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds / xyloglucan:xyloglucosyl transferase10287e-112

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
123  8%
 
910  26%
 
109  23%
 
212  5%
 
84  10%
 
73  8%
 
185  13%
 
203  8%

Unigene MembersMember information