Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18260

FASTA Sequence
Unigene ID: UN18260Length: 2349 SSR 
GGGAACCTTAAGCTCTGTTTTGTTGTAGAAACAGAGGATTCGAACATGGTGGTTGGTAGTATTGTCGGCAGTAACATGGCGGCAAC
AGATGCGAGGTTTCTAAGTTCGAACTTTGGCAACACTTTCAGCATCAATACCAGAATTCACAGATGGGATTTTCACGATCGGTCCC
AGATCGCAATCCCTAGGGCTCAATCTTCTTCTTCTTCTCCACCTCCGCCTCCGCCTTCATCCTCCGACAAGAATCGCCGCGATAAG
AAGCCCAGAAACCGACCCGCAACCACAGCTACTAAGGAAAGCGAAGAGACGGTTGAGTTGTCTAAGAAACTTTCACTTCCACTAGG
TTCCACTCTTGACAGGTATGAAGGCTTAGTTCTTTCTGTTGGTGGGAATGGAAGATCCTATGTTGTAATCCTTGAAGCTGGTCCAT
CATCAGATATGTCTCAGAGCAAACTCTATTTCGCAAGGATTACTACCAAAGCTGGATTTTGTCGGGTAAGGGTACCGTTTTCAGCT
TTCGTCCGGTAACCTGAAGATCCACCGCTAGATCCGTTTCTCGTCATACATGACAATACGTTTTGAGCCTAAGAGACAGAGACCAG
TTGATGGTGTTGCTGGTGCACAACAAGATCTAAGAAGCTTTAGCCTTGTATTCGAGTACATCAAAGCTTTGCCTGCGGGTCAAGAA
ACCGATTTTATTTTGGTTTCATGTACTGGTTCTGGAGTAGAACCCAACAGAAGGGAGCAAGTGTTAAAAGCTAAGAGAGCTGGTGA
AGATTCATTGAGAAGATCAGGCCTTGGATACACCATTATTCGTCCCGGTCCCTTGAAGGAAGAGCCAGGCGGTCAACGAGCTCTGA
TATTTGATCAGGGAAACAGAATATCTCAGGGAATCAGTTGCGCTGATGTGGCTGATATTTGTGTCAAGTCACTACACGATTCAACA
GCGAGAAACAAAAGCTTTGATGTTTGCCATGAATACGTCGCTGAGCAAGGAATAGAACTGTACGAGCTGGTGGCTCATTTGCCAGA
CAAGGCGAACAACTATCTGACTCCTGCTTTATCTGTACTTGAGAAGAACACATGATACACAAAGTGAGAAAAGAAGAACCCTTGAT
TCCCATTTTGTCTCTTGTAATTCATCTCAACCCCCATATCCATATACACTACTACATAAATACATACGTCTCTCTTGTATAATTTT
GTACAGACAAAGAATCTCTTCTTCCTTCCTTCCTCGGTATCTATCTCCAGTAACATTGTTTTCTTATATTCAGCTTTTTGAGTTTG
TGTAGTAATACAAGAAAAGGGTGTGAGACTCTTGTTTTCTATTACACAACAACTCAGTATAAAAATGAGTCATTGATACAGCTAAA
AGCGTGCATCTTCTTCGCTAATATTATTAGCAAACATGAGATTATTTCAAATTGTCTCATAATGAAGACGTCGGAGACACATAGGC
AACTTCCCGGCGAAGTTTTCTCCGGAGCTTTCTTTTGATTCAAGTCTCATCTTCTTCCTAACGTGCTAATGTTTTTTTTCCTGACG
TGGCAGCACACGTCTTCTGTTGGGCGATAATGGATGAGGCCCATTAAATTGAGTAATGGGCTTTACTGTGTTAAATAGGTTATTTA
ATTGTTACCGGGTTTGGATGTGGTCCGACCCGACAGGGAATTGAAAAACAAAGGGAAAACACAGAGGCGGCGGCGTTAAACAGTGA
GAGAGACAAGGAAGAGGAAGAGGAAGAGGAAGAGGAAGAGGAGAGGAGAGGAGAGGAGAAAGATGAACAAGAAGGAGATCTTCAAG
CTAGCAAAGGGTTTCAGGGGAAGAGCGAAAAACTGTATAAGAATCGCGAGGGAGAGAGTAGAGAAAGCTCTTCAGTACTCTTACAG
AGACAGGCGCAACAAGAAACGTGAGATGCGAGGTCTCTGGATCGAGCGTATCAACGCCGGCTCTCGTCAGCACGGTGTACGTTCTG
ATTGCTTCGTTTACTGCTAGATTCCTTTGATTCCCTTTCGTTCTAGCTGCGACGGATTAGTTTAGAAATGAGACTTTTGAGATATA
GTAAAATGCAAATCTAGATCAAATCATTTTAGGGTTTATGATGATTAGAACCACAAGTTGTAGCTTGATTTTTTAACAGAACTCTG
ATGGATCAGGTTTGTAGTTTTGTTTCTCGATGTTTTTTTTTATTGCAGTGGTTCTCTGTGTTTGCATCCACGTGGAAATAGAGGTT
ATTGTGTATAACTAGAAAGAAGATCGATAGAACTTGGATTAAGGGCATTTCAGATTTTGCTTATGAAGAAAATTTCTGGAATCTTT
TAACATTTTAAAGCCTTGAAACACGTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33598 unnamed protein product [Thellungiella halophila]8833e-092
XP_002890185 oxidoreductase/ transcriptional repressor [Arabidopsis lyrata subsp. lyrata]8753e-091
AAG09086 Unknown Protein [Arabidopsis thaliana]8735e-091
NP_173116 high chlorophyll fluorescence phenotype 173 protein [Arabidopsis thaliana]8735e-091
CBI18357 unnamed protein product [Vitis vinifera]8206e-085

Swiss-Prot top hits (Blast detail)Scoree value
B3CLK2 50S ribosomal protein L202503e-020
Q3YSX0 50S ribosomal protein L202477e-020
Q9ZCV0 50S ribosomal protein L202451e-019
Q2GHR2 50S ribosomal protein L202442e-019
B3CRZ0 50S ribosomal protein L202442e-019

TrEMBL top hits (Blast detail)Scoree value
Q8W4D6 Putative uncharacterized protein At1g167208733e-091
Q9FWQ6 F17F16.7 protein8733e-091
A9PHQ9 Putative uncharacterized protein8196e-085
B9N5C7 Predicted protein8196e-085
B9HG16 Predicted protein (Fragment)8171e-084

Arabidopsis top hits (Blast detail)Scoree value
AT1G16720.1 HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor8741e-093
AT1G16740.1 ribosomal protein L20 family protein3329e-031

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  18%
 
62  18%
 
121  9%
 
92  18%
 
102  18%
 
81  9%
 
71  9%

Unigene MembersMember information