Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18473

FASTA Sequence
Unigene ID: UN18473Length: 941 SSRSNP
TTTTTTTTCCCGTCTCCTAGCTGACTAAATAACCCCTCTTTCTTTACTCTCTCTCTCTCTGCTCAAATCGAAATTAGGGTTCGAAG
TTTGACGGCGAGAAGATGAGTGCTTCAAGGTTCATAAAGTGCGTCACCGTCGGTGACGGCGCCGTCGGCAAGACTTGTCTACTCAT
CTCCTACACAAGCAACACTTTCCCCACTGATTATGTGCCAACTGTGTTTGATAATTTCAGCGCTAATGTGATTGTTGATGGGAACA
CCATCAACTTAGGATTGTGGGACACTGCAGGACAAGAGGACTATAATAGACTAAGACCATTGAGCTATCGTGGTGCTGATGTCTTC
TTGCTCGCATTCTCTCTCGTCAGCAAAGCTAGCTATGAAAATGTTGCTAAAAAGTGGGTTCCTGAACTCAGACATTACGCTCCTGG
TGTTCCCATCATCCTTGTTGGAACAAAGCTTGATCTTCGAGATGATAAGCAGTACTTTGTTGAGCACCCTGGAGCTGTGCCTATAT
CTACTGCTCAGGGTGAAGAACTGAAGAAGCTTGTTGGAGCTTCTGCTTATATAGAATCCAGTGCAAAGACACAACAGAATGTAAAA
GCTGTCTTTGATGCGGCTATTAAAGTAGTTCTCCAGCCACCTAAAAACAAGAAGAAAAAGAAGAGAAAGTCTCAGAAAGGCTGTTC
TATATTGTGATTCCAGAGAAGAAGAAACACACAGTTATAAATTTATAACTAATCCTTGTTTCCGAGTGCTACGGACCCATTTTTCT
TACTTCCATGAAACAGGAATCTGTTGTTTTGTAGTCTGAATACTGACATCAGAAGAAACTCATTGGTCTTTATTTGAGGTTGTATT
CTTGTTTGCATTCCGAATATGTAAATATATGATGATACCACGTTTGCTTTTGATTCCATTATAGAGACTATTTACTGCGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195228 Rac-like GTP-binding protein ARAC3 [Arabidopsis thaliana]9967e-106
AAO42256 putative Rho1Ps homolog Rac protein [Arabidopsis thaliana]9932e-105
AAB38780 Rho1Ps homolog [Arabidopsis thaliana]9895e-105
AAB97458 rac-like small GTP binding protein [Brassica rapa subsp. campestris]9861e-104
AAD47828 RAC-like G-protein Rac1 [Gossypium hirsutum]9618e-102

Swiss-Prot top hits (Blast detail)Scoree value
Q38912 Rac-like GTP-binding protein ARAC39963e-107
Q6EP31 Rac-like GTP-binding protein 59481e-101
O04369 Rac-like GTP-binding protein RAC19255e-099
Q39435 Rac-like GTP-binding protein RHO19239e-099
Q38937 Rac-like GTP-binding protein ARAC59212e-098

TrEMBL top hits (Blast detail)Scoree value
Q5PNX9 At4g350209965e-106
O49180 Rac-like small GTP binding protein9867e-105
A5AP72 Putative uncharacterized protein9616e-102
Q9SWE8 RAC-like G-protein Rac19616e-102
Q9ZRD2 NTGP39544e-101

Arabidopsis top hits (Blast detail)Scoree value
AT4G35020.1 ARAC3 (ARABIDOPSIS RAC-LIKE 3); GTP binding / GTPase9972e-108
AT1G75840.1 ARAC5 (RAC-LIKE GTP BINDING PROTEIN 5); GTP binding / GTPase9211e-099
AT2G17800.1 ARAC1; GTP binding9202e-099
AT2G17800.2 ARAC1; GTP binding9202e-099
AT1G20090.1 ROP2 (RHO-RELATED PROTEIN FROM PLANTS 2); GTP binding9149e-099

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
78  62%
 
101  8%
 
181  8%
 
121  8%
 
201  8%
 
91  8%

Unigene MembersMember information