Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18502

FASTA Sequence
Unigene ID: UN18502Length: 569 SSRSNP
CGGTTTTATTACATGACATATACTGATTAACAAATTTTTCATGGCCTCAGTCAAAATTCTTAATCGGCTCCCGATAACCACAAATT
GAAACATTAATATATATAAAAATAGCAAATATTCCAAACTTAGTAAAATTAAACACGAGAAAATTAAAGTTGCAATACATATATAT
ATATATAACATGCTGCATATAAGACATATATCTGTCACATGCAACGGTTTATTATTCGGTTATAGAATACTAAGTGGGAAATTATA
AATATCTCCACATACTCATTTTTTTCATTTCTTATTAAGCTGACGCTGGTTCTTGAAGTGGTCTCTTGGGTTGGCTTCGAAAGGTG
CCCTAGGAATAATAGAACCATTCCCACCAGGAGCCTTCATCATCTTCTCTTTTGGACCGTTCTCTTCCGAGCCTGAGGTCATCCAC
GAGAATAGACTCACGGCCGCTCCAATGGCTCCAACCACACCTATGACTTTCGTTGCGTTATCGTAAAATGTCGAACTCTCATCCTT
GTCATCTTTTCTGCTCATATTGATATGGTCACTATATGAGTGTTTTGACTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002868684 expressed protein [Arabidopsis lyrata subsp. lyrata]2193e-016

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits Scoree value
No hits found  

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  7%
 
197  25%
 
129  32%
 
65  18%
 
181  4%
 
202  7%
 
92  7%

Unigene MembersMember information