Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18633

FASTA Sequence
Unigene ID: UN18633Length: 1258 SSR 
AAACCAACCGGGCTGATTCAGCCCCCCACATCCTCTCTTTTTAATAAGTATTAACATGAACAATTCTTTATCAAACCCCACGTTTA
CATTTTTTTTTTACATGAAAATGTTTTGTCTTTTATACCAACATCATCCTTAGAATGCATTATGAATTTTGAAGTTAGAAGAGAGA
AATTGAATATCGTGGTCTCTTCTTCTTCTTCTTTCTTCACAAGCACACACACACACACTTGTTTTTGTTCTGAGAAGGATCTTCTT
TATAGTTCTTAGACAGACTCAACTCCTTCGCCTTGTTGCTGTGCAAGATATCTCTCTCGTCGCTCCTTCCATTCATCGATCACAAG
TCCTTCTCCAATCATCTTTGGACCTGTTTCCTCTGGTGGTTTCTTTCTTGTCTCCACTGCTGCATCCGCTTCAGCTAACTGACGCT
TCAGTTTCTCCAGTGCAGGGTTCGGACGTTCTGGATCCAAGAAGATAACACGCAATATTTGCTCCTTGGACACATCATCTTTTTGC
TCATCAAACAGCTCAGGCACATAGTCCATTGGACCTTTCACCTTCAGGCTCATGATTTTAAACTTAACCCTGCTCCTCTGATCCAT
TGGCTTCTCATTATTCTCAGGAGGCTCAACAAACTTGAAAACAGTGGCGATAATAGTCTCTCCAGGAGCAAGAATAGCACCCGGTG
GACGCATGAAGCAACTCTTCGGCTCAGTTGTTTGAAACTTGAACGCTACATGTGATTTGCTGGTGTTTTTAATCTTAATAGCGCTC
CTTACTTGCTTCCCAGGCTCATAAGGGAAGTAGAGTTTCTCGGACGGATCAAGCTTCAATCTGCGTTTTACAGGCAGAAGCGACTT
AGCGACGGACGATACCGAAGGCGAAGGAGTCGGGTGCTGATTTTGACCCGATCCGTCGCCGTGTGGCCCGTTGTAGCCACCATGAT
GATGGTGGTGGTGGTGGTGATGGTGGTGGTTGTGGATATGATGAGAAGAAGAGGAAGAAGAAGCTCCCGATGGAAACGGAGACGTG
GCGGCACTACTAGAGGCGTTTCCGTGAGAGTTTCGAAACGGGATTTTGAAGATACCCCAGCCTCGGCCATCGGTGGTTGGTTTCTC
CTCCGTCGTCATGGTCATCGGAAGCCGATTCGCGCGACGGATAAACGGTGAAGATAGAGTTTGACTTGTGAGATGAGAGAGAGAGC
TGTGTTGTTTGTTTGTGATGGAGTAGAGAGGAGAGAGAGAATGAGATCGGACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869886 vesicle-associated membrane family protein [Arabidopsis lyrata subsp. lyrata]13956e-152
NP_567627 vesicle-associated membrane family protein [Arabidopsis thaliana]13859e-151
NP_567287 vesicle-associated membrane family protein [Arabidopsis thaliana]9979e-106
AAM65052 membrane associated protein-like protein [Arabidopsis thaliana]9914e-105
XP_002317246 predicted protein [Populus trichocarpa]9914e-105

Swiss-Prot top hits (Blast detail)Scoree value
Q24523 Protein bunched, class 2/F isoform1327e-007
Q0KHT7 Probable serine/threonine-protein kinase CG326661327e-007
Q8MP30 Uncharacterized histidine-rich protein DDB_G02745571327e-007
Q54GQ1 Myotubularin-related protein DDB_G02900051301e-006
O42980 NEDD8-specific protease 11301e-006

TrEMBL top hits (Blast detail)Scoree value
Q8VYN2 Putative membrane associated protein13856e-151
O65410 Putative membrane associated protein12979e-141
Q8LPQ7 AT4g05060/T32N4_129976e-106
B9HYN1 Predicted protein9913e-105
Q8LAZ8 Membrane associated protein-like protein9913e-105

Arabidopsis top hits (Blast detail)Scoree value
AT4G21450.1 vesicle-associated membrane family protein / VAMP family protein13863e-153
AT4G05060.1 vesicle-associated membrane family protein / VAMP family protein9982e-108
AT4G21450.2 vesicle-associated membrane family protein / VAMP family protein9713e-105
AT5G54110.1 ATMAMI (ARABIDOPSIS THALIANA MEMBRANE-ASSOCIATED MANNITOL-INDUCED); structural molecule8235e-088
AT3G10810.1 zinc finger (C3HC4-type RING finger) family protein1595e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  13%
 
72  25%
 
181  13%
 
211  13%
 
122  25%
 
111  13%

Unigene MembersMember information