Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18641

FASTA Sequence
Unigene ID: UN18641Length: 611 SSR 
GGGTCACAGAAACAGAGATTCCTCGCTGTCTGAACTGAAAAATAAGATCGCATTAACTCAAAGCGCTCACAAAGACAAAGATCTTC
TTCTTCTTCTTCTTCTTTCTCTTTTCTCTTTTCTCTTTCAGATAACGATGGAGAACCCTCCGGATCAAACAGAGTCAAAGGAGATG
ATGCTTCAACCCATAAGAAGAAGACGAAAGGGTGGTCTTCTCACTATGCCCTTCATCATTGCAAACGAGGGGTTTGAGAAAGTGGC
GAGCTACGGATTACTACAGAACATGATACTCTACCTGATGAGTGACTACGGTTTGGGAATTGTGAAAGGACAAACCGTGTTGTTCA
TGTGGGTCGCTGCTACTAACTTCATGCCTCTCGTTGGAGCTTTTCTATCAGATTCGTATTTGGGTCGCTTTCTCACCATCGCCATT
GCCTCTCTCTCCAGTTTCCTGGGGATGGTGCTACTATGGCTAACGGCGATGTTACCGCAAGTGAAGCCATCACCGTGTATAGCATC
AGCCGGAACCAACTGCAGTTCCCCGGCAGCGACATCTTCTCAACTGGCTCTTTTGTATTCCGCATTTGCACTTATATCGATCGGAC
CAGGTGGTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_188239 major facilitator protein [Arabidopsis thaliana]7096e-073
AAM20441 putative transport protein [Arabidopsis thaliana]7096e-073
XP_002885127 proton-dependent oligopeptide transport family protein [Arabidopsis lyrata subsp. lyrata]7071e-072
XP_002891678 proton-dependent oligopeptide transport family protein [Arabidopsis lyrata subsp. lyrata]5733e-057
NP_175630 putative peptide transporter [Arabidopsis thaliana]5691e-056

Swiss-Prot top hits (Blast detail)Scoree value
Q9M817 Probable peptide transporter At1g521905695e-058
Q9M390 Peptide transporter PTR12075e-016
Q05085 Nitrate/chlorate transporter1941e-014
Q9LFB8 Peptide transporter PTR51644e-011

TrEMBL top hits (Blast detail)Scoree value
Q8LPL2 Putative transport protein (Fragment)7094e-073
Q9LW69 Peptide/amino acid transporter-like protein4901e-047
B9RQI9 Nitrate transporter, putative4622e-044
Q2HU49 TGF-beta receptor, type I/II extracellular region4381e-041
B9H904 Predicted protein4102e-038

Arabidopsis top hits (Blast detail)Scoree value
AT3G16180.1 proton-dependent oligopeptide transport (POT) family protein7093e-075
AT1G52190.1 proton-dependent oligopeptide transport (POT) family protein5695e-059
AT5G28470.1 transporter3033e-028
AT1G69860.1 proton-dependent oligopeptide transport (POT) family protein2991e-027
AT5G11570.1 proton-dependent oligopeptide transport (POT) family protein2765e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  33%
 
91  33%
 
111  33%

Unigene MembersMember information