Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN18755

FASTA Sequence
Unigene ID: UN18755Length: 2110 SSRSNP
GGACAAGAAGAAACTTTCTCTCCCTAACTAAAATGATTAAAATGGCAAACGCCGGTCTCTTTCTCCGGCCTTTCATCCTCGCCGTT
CTCTCCCTCCTCCTCCTCTCTTCTTCCGTCTCCTCCTCCACCGAGTGGCTCGACATCGATGCCTCAGATCTCAAAGCTCTTCAAGT
CATCGAAACAGAGCTCGGAGTCAACAGTCAACGCTCTTTGTCCACTGGTGTTAACCCCTGCGGTCACGGAGGAGTTTTCTGCGAGA
GAAGACTCTCCTCCTCCGCCACCGGAGAATACGTCCTCCGTGTCACAAGACTCGTCTACCGATCCAGGACCTTGACGGGGACCATC
TCGCCGGTGATCGGAAAGTTGTCGGAGCTCAAAGAACTCATTTTGTCTAATAACAAGTTGGTCAACGGTCTTCCCGTTGATGTCTT
GAGCTGCAAGAAACTCGAAGTACTTGATGTAAGAAACAACAGGTTTTCCGGCCAGATTCCGGGGAACTTCTCTCGTCTGGTCCGTC
TTCGAATCCTCGATCTTTCCTCGAACAAGTTCTCAGGGAACTTGAACTTCTTGAAGAACTTACGCAACTTGGAGAGTCTCACCGTT
GCAAACAATCTCTTCTCAGGCAAGATCCCAGAAGCGGTTGACTCCTTCCACAATCTCCGGTTCTTTGACTTTTCTGAAAACCGGTT
TTTAGAAAGTCCGGTTCCGGTTATGAGCAAAACCAAGCTTCAGACAGTTTCACACCAAACCAGACACATTCTTGCTGAGACTCAAT
CTACAAACTCCACCAAGAAAGCCAACAACACCACCACCACATCAAAAGCAACTTCAGACCATGATAAAAAGAAGATGAAGAAGAAG
AAGAACAAGAAGAAGAAAGTATTGGCATGGATCTTAGGGTTCGTCGTTGGAGGCATAGGAGGAACACTCTCTGGTTTCGTCTTCTC
TGTTATATTCAGACTGGTTCTTCGAGTAATAAGAGGACCAGAGAAGCCATCAGGTCCTACCCTATTCAGTCCAATGATCAAGAAAG
CTGAAGATTTAGCTTTCTTGGAGAACGAAGAAGCGTTAGCTTCTCTAGAGATCATTGGAAAAGGAGGCTGCGGAGAAGTTTTCAAA
GCTGAACTACCTAACAGCAACGGGAAGATCATCGCTGTGAAGAAAGTGACACAACCATCTAAAGAAGCCAATGAACTTGTAGATGA
AGAGTCCAGGTTTCTGAACAGGTTCATGAGGCAAATCAAATCAGAGATCAACACAGTGGGTCACATCAGGCACAGGAATCTTCTCC
CGTTGTTAGCACACGTTCCGAGACCCGAGTGCCACTATCTAGTCTACGAGTACATGAAGAACGGGAGTTTGCAAGATATACTGACC
GATGTGGCTGCTGGAAACAAAGAGTTAATGTGGCCAGCAAGGCACAAGATTGCTGTAGGTATAGCTGCAGGGCTTGAGTACCTTCA
CACGGATCATAAACCAGCAATCATTCACAGAGACTTGAAGCCAGCGAATATTCTTCTAGATGACGACATGGAGGCTAGAATTTCGG
ATTTCGGGCTGGCGAAGGTGATGCCTGATGCAGTCACCCACATTACAGCCTCGAAACTTGCAGGCACTGTGGGGTACATAGCATCA
GAGTATCATCAGACTCTCAAGTTCACGGATAAATGTGATATCTATAGTTTTGGAGTGATTCTGGGGGTTCTTGTGATTGGGAAGCT
TCCTTCGGATGAGTTTTTCCAGACTACTGAAGAGATGAGTCTGATAAAGTGGATGAGGAACAAGGTAACATCGGAGAATCCAAGCC
TTGCTATTGATCCGAAGCTGATGGAGCAAGGATTCGATGAACAGATGCTTTTGGTTCTGAAAATCGCTTGTTACTGCACTTTGGAT
GATCCGAAACAGAGGCCGAACAGCAAAGATGTCAGGACTATGTTGTCCCAGATCAAGAGCTAGTCTCTCTCTCTCTCTATGATGTA
TTGTTTGCTTCTAAATGTGTATTCTATATTCCCTGTTTGAGAAATAACTAGGAACACAATAGTGTTTACTTGGCAGAAGCTTGTGA
TCAAGATGTATGATTTAAATGGTTTTAATTATGTTTTCTTAAGTCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180747 putative leucine-rich repeat transmembrane protein kinase [Arabidopsis thaliana]26575e-298
AAL25569 At2g31880/F20M17.8 [Arabidopsis thaliana]26442e-296
XP_002879347 hypothetical protein ARALYDRAFT_482113 [Arabidopsis lyrata subsp. lyrata]26389e-296
XP_002318094 predicted protein [Populus trichocarpa]20885e-232
XP_002511283 BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 precursor, putative [Ricinus communis]20698e-230

Swiss-Prot top hits (Blast detail)Scoree value
P47735 Receptor-like protein kinase 55075e-050
Q8L899 Systemin receptor SR1604781e-046
Q8GUQ5 Brassinosteroid LRR receptor kinase4762e-046
Q9ZWC8 Serine/threonine-protein kinase BRI1-like 14743e-046
Q9LJF3 Receptor-like protein kinase BRI1-like 34717e-046

TrEMBL top hits (Blast detail)Scoree value
Q9SKB2 Leucine-rich repeat receptor-like protein kinase26574e-298
Q93Z40 At2g31880/F20M17.826441e-296
B9I3J0 Predicted protein20884e-232
B9RAQ8 BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1, putative20696e-230
B9IF16 Predicted protein20472e-227

Arabidopsis top hits (Blast detail)Scoree value
AT2G31880.1 leucine-rich repeat transmembrane protein kinase, putative26572e-300
AT5G49660.1 leucine-rich repeat transmembrane protein kinase, putative5362e-054
AT1G55610.1 BRL1 (BRI 1 LIKE); kinase4743e-047
AT1G55610.2 BRL1 (BRI 1 LIKE); kinase4743e-047
AT3G13380.1 BRL3 (BRI1-LIKE 3); ATP binding / protein binding / protein kinase/ protein serine/threonine kinase4716e-047

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  42%
 
213  16%
 
191  5%
 
141  5%
 
122  11%
 
101  5%
 
92  11%
 
61  5%

Unigene MembersMember information