Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19219

FASTA Sequence
Unigene ID: UN19219Length: 2251  SNP
TTTTTGTGAAAACATAAAAACTCTTTGGTTGCTTCAAGATCCTGAAAATCTGGTAGAAAAAAATGCTGGAAGTTGGAAGTTCCAAT
GCCCTCTTTTTCCAAACAAACACTACTTGTAATAATCTTCTCCGCGAGCTTCAGAAAATATGGGTTGAAATTGGTGAGAGTGAGGC
TGAGAAAGACGGGATGCTGATGGAATTGGAGAAAGAATGTCTTCAAATCTATCAAAAAAAAGTTGAGGAGGCTGCAAATTCTAAGG
CAAGGCTTCATCAGTCTGTTGCAGCTATAGAAGCTGAAGTTGCCTCTTTGATGGCTGCTCTTGGAGTGCTAAACATCAACTCCCAG
ATAAAAATGGATAAAAGCTCAAAATCATTGAAAGAAAAGCTTGCAGCTGTAACCCCTCTTGTTGAGGACTTGAGGATTCAGAAAGA
GGAGAGAATGAAGCAGTTTTCTGACCTGAAGGCCCAAATCGAGAAGATTAGTGGAGAGATTTCAGGATACAGTGAACATCTCAGCA
AGGGCATGATCAGTTCCTTGACTCTTGAAGAACAAGACTTGACTCTCAGAAAACTCAACGAGTATCAAACACATCTCCGCACGCTT
CAAAAGGAAAAGTCTGATCGCCTCAACAAAGTCTTGGGTTATGTCAACGAGGTGCACACGCTTTGCGGTGTCCTAGGAGTTGACTT
TAGTCAAACGGTTTGCGAGGTTCATCCGAGCTTGCATAGGACAGACCACGAGCAGTCTACAAACATTAGTGATAGCACATTGGAAG
GACTGGACAACATGATTCAAAAGCTAAAAACCGAAAGAAGAGCTCGATTTCAAAAGCTGAAGGATGTAGTGGCTTCGCTTTTCGAG
CTATGGAATCTAATGGACACACCACATGAAGAGAGAACTAAATTTGGAAGAGTTACATATGTTGTGAGATCATCTGAATCTAACGT
CACTGAGCCAGGCATCTTATCAGCCGAGACAATTGAACAGGTGTCTACGGAAGTGGAGAGTCTGAGTAAACTGAAAGCTAGCAAAA
TGAAGGAACTGGTGATGAAACGGAGGTCCGAGTTGGAGGATCTTTGCAGACTAACTCACATTCAACCTGATACAAGCACTTCGGCT
GAGAAATCAAGTGCACTAATAGATTCTGGGTTAGTGGAACCTTCGGAGCTTCTTGCAAATATAGAAATGGAAATAAACAAGATTAA
AGAGGAAGCACAGAGCCGTAAAGACATCATGGACAGAATTGACCGTTGGCTCTCTGCATGTGAAGAGGAAAACTGGTTGGAAGAAT
ATAATCTGGATGAGAACCGTTATAGTGCTGGAAGAGGTGGACATGTAAACCTTAAGCGTGCAGAACGAGCCAGAGTTACAATCAAT
AAGATCCCAGCGATGGTTGACAATCTTATTAAGAAAACTCTAGTTTGGGAAGAGGAAACGCACAAGTCATTTCTCTATGATGGTGT
TCGGTTGGTTAACATACTAGAAGACTACAAGTTAACAAGGAAACAACAGGAAGAGGAAAAGAAAAGATACCGGGACCAAAAGAAGA
GGCAAGATCTCCTACTAACCCAAAGGGAATCCATATATGGATCAAAACCGAGTCCAAGAAGAAGCAGCAGCTTCAGGAAGCCTAGT
GGTTACAGCATTAGCAATGGGAATGGTTCAATGCCTCCCACACCTCGCAGAAGCTCAGTGGGGACAACAACACCTGACCTTCTTCT
GACCCCGAGATCTTACTCGGGTCATCATCGCCAAAACGGGTATTTTAAAGAAGTTAGGAGACTCGCTTCTACTCCCTTAAACTATG
TGGCCATACAAAAGGAAGATACTGCTTCTACTACTTACACATCGATCTATAGCTCTGAGCCAGACTCACCTCTCCAAGGCTGACTT
TGACTCTCCTTTGCACTGAGATTCATGTTAGAAGTTGGATATATGTATGTGGTTAAGGATTTGGGAAGTAATCTTTAATAATGACG
TTATCGTAAAGAAGAAGTCAGTGATGGATGAAGATGCAGACTTGTGAATACAGAAAGGTGACTTGACTTGTTTAGGGGAGATATGG
TGAGACAATGAGTATAAAATAAAACTGTATCTGTAACTCTTTTTAATCTTGCAGTGAGAAAATACTATTTTTGCCGTGTGAAAGTG
CGTTTGTGTTTGTGTACTTATTTGTGTATATAAAATATACGTATTTGTTTTGAGATGTGATGCTTTGATATTTTTTTGGTGTGGTT
TCAGTAATACTTTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACQ90586 putative microtubule-associated protein [Eutrema halophilum]28750.0
XP_002875099 atmap65-6 [Arabidopsis lyrata subsp. lyrata]28500.0
ADQ43179 unknown [Eutrema parvulum]28390.0
NP_178300 microtubule-associated protein 6 [Arabidopsis thaliana]28350.0
NP_001030945 microtubule-associated protein 6 [Arabidopsis thaliana]26495e-297

Swiss-Prot top hits (Blast detail)Scoree value
Q9SIS3 65-kDa microtubule-associated protein 628350.0
Q8L836 65-kDa microtubule-associated protein 724216e-272
Q9FLP0 65-kDa microtubule-associated protein 113265e-145
Q8LEG3 65-kDa microtubule-associated protein 212333e-134
Q9FHM4 65-kDa microtubule-associated protein 311903e-129

TrEMBL top hits (Blast detail)Scoree value
C7SI04 Putative microtubule-associated protein28750.0
B9S7E4 PLE, putative21808e-243
B7FLP3 Putative uncharacterized protein (Fragment)17722e-195
C5X272 Putative uncharacterized protein Sb02g02626017084e-188
Q0J1C5 Os09g0450300 protein17067e-188

Arabidopsis top hits (Blast detail)Scoree value
AT2G01910.1 ATMAP65-6; microtubule binding28360.0
AT2G01910.2 ATMAP65-6; microtubule binding26501e-299
AT1G14690.1 MAP65-7 (MICROTUBULE-ASSOCIATED PROTEIN 65-7)24215e-273
AT1G14690.2 MAP65-7 (MICROTUBULE-ASSOCIATED PROTEIN 65-7)24215e-273
AT5G55230.1 ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding13265e-146

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  15%
 
121  8%
 
102  15%
 
92  15%
 
62  15%
 
73  23%
 
191  8%

Unigene MembersMember information