Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19544

FASTA Sequence
Unigene ID: UN19544Length: 1354 SSR 
GGGTCGATCAAACGACGTTTTATCTCTCCATCTCCACTATAATCGATCTGTAGAGTAATCAATTGTCCAACGACTCCCTACTTCAG
GGGAGCAAATTGATTGAGGGGGAGAGAGCGTACGAATCGGAGATGTCGAACGGTACGGATCAGTCGCGGAAGCGTGCGGCGCCGGA
AGACAACAATTGGTTGCCTCCTGGTTGGAGAGTTGAAGACAAAGTTCGAACCTCCGGTGCTACTGCTGGTTCCGTTGATAAGTACT
ATTATGAACCAATCACAGGATGTAAGTTTCGATCCAGGACCGAAGTGCTCTACTACTTGGAACATGGGATTTCTAAGAAAGGAAGC
AAGAAACCAGACAAAGCTGATTCCAATTCAGACCATTTAGAAGGGCAAGGAAGCAATGAATCCAGCAGAAAATCTAAAGAGTAGCC
TCCTCCTCCTCCGCCTCGGCCACCATCGCCGCCATTGAAGTTTGATTTTTGAGAATCCGCCTGAGAAGGTAAGCTGGTCTGTGGCA
AAAGCAGGAGAGGAAGCTTGGACACCTTTTGTTAGGGATGACAAGGTTCAAGATTCGTTGAGACGAGAATGGTGCACTGCGTTTAA
CGTTATCACGACCAAGAACCCAACTAAACTGTCGTCGTTGAGACGACGATGATGATGATGATAGGCAAGCTGATTTCAGATAACCG
TCTATCTCCAAAATCATGGTGTGCTGTTGGGAGATATGCACATATGCTTTCTGGTCACGAGTACAATTATTTTCTATTTCCCTCTT
TTTCTTATTAGTCATATCTACGTTAACAAATCGAACCCAAGACTGTCCCTTCTCATTTGTATTTATGTTTCCATGTAGCGGTTTAG
TAGAGGCCAGTATATCCATCTTCTAGGCTGGGAAAAGACGGGGACAAGCTGAAAGCTGAAGTGAAGAAACATGTTCCTCTTTTAGC
TCGAGATTTTGCTTTGCTTTGCTTTACTTTATACTGTTTCTAACTATCGTTTTTGAGTACAGCATAAGGGATGAAAAGCTAGATGG
ACATGCAGGTATATATGAGCAAGTTTTCCAGTGATATATTCCAGAGGACGGATGAGGACGTGACACAAACCATGAACAAATAAATC
ATTTGTCCTTTTGACAGACAATTTAGTTTCTCGGGTGGTTTTGGGTGTGCCGTTCGGAGTAGAGAATGATAATGTTACAAACGGGA
GAGTCGTTAGGAGTACAAAAGAGGACGAGAAGGAAAATTACTCTGAAATCTAAGCTAAATGGTACTATCTTTTTCAAGTACCAAAA
TATAATTTGAAAGTAGTAGAAATATTGTATACACTCTGATCTAATAAAATTTAGCTATTATCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002864630 hypothetical protein ARALYDRAFT_919168 [Arabidopsis lyrata subsp. lyrata]4153e-038
NP_200746 methyl-CPG-binding domain 6 protein [Arabidopsis thaliana]4144e-038
XP_002875791 hypothetical protein ARALYDRAFT_485028 [Arabidopsis lyrata subsp. lyrata]3445e-030
NP_190242 methyl-CPG-binding domain protein 5 [Arabidopsis thaliana]3355e-029
AAM63666 unknown [Arabidopsis thaliana]3355e-029

Swiss-Prot top hits (Blast detail)Scoree value
Q9Z2E1 Methyl-CpG-binding domain protein 21363e-007
Q9UBB5 Methyl-CpG-binding domain protein 21345e-007

TrEMBL top hits (Blast detail)Scoree value
Q9LTJ1 At5g593804143e-038
Q8LCG6 Putative uncharacterized protein3354e-029
Q9SNC0 Putative uncharacterized protein At3g465803354e-029
B9T3M7 DNA binding protein, putative2422e-018
A9PAN4 Methyl binding domain protein2271e-016

Arabidopsis top hits (Blast detail)Scoree value
AT5G59380.1 MBD6; DNA binding / DNA demethylase/ methyl-CpG binding4141e-040
AT3G46580.1 MBD5 (METHYL-CPG-BINDING DOMAIN PROTEIN 5); DNA binding / methyl-CpG binding3352e-031

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  67%
 
82  22%
 
121  11%

Unigene MembersMember information