Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19567

FASTA Sequence
Unigene ID: UN19567Length: 982 SSRSNP
GGAAAACAAGCCCTATCTCCCTGGTTATACACAAAGACAGAGAAGTTCAAGACGAAAGAAAAGAGGTTCTCTTTGTACACAAAGAA
GGGCCTCTTTGTGTGTGTGTGTTTTCAGAGAGAAGATGGCTAGTACGTTAGATGTATCCAGAGCAGAGCTTGGTCTAGTGGTTATG
TATCTTAACAAAGCAGAGGCAAGGGATAAGTTATGCAGAGCTATACAGTATGGTTCAAAGTTCTTGAGCGGTGGACAACCTGGTAC
TGCTCAAAACGTTGATAAATCCACTACCTTAGCCAGAAAAGTCTTCCGTCTTTTCAAGTTTGTTAATGATTTACATGGTCTTATCA
GTCCTGTTCCTAAAGGGACTCCACTTCCTCTCGCTTTGCTTGGAAAGTCCAAGAACGCACTCTTGTCTACATTCTTGTTCCTGGAT
CAAATCGTCTGGCTTGGAAGATCAGGAATCTATAAGAACCAAGAGCGAGCTGAGTTACTTGGACGTATATCAGTTTTCTGCTGGAT
GGGATCATCTGTCTGTACAACTTTAGTTGAGCTTGGTGAGATTGGAAGGCTCTCATCGTCGATGAAGAAGATCGAGAAAGGGCTTA
AGAATGGCAACAAGTATCAAGATGAGGAGTATCGTGCCAAGCTTAAACAGTCTAACGAGAGGAGTCTTGCTTTGATCAAATCAGCC
ATGGACATTGTTGTAGCAGCTGGTCTTCTTCGGTTATATCCAGAGAAGATCACTCCTCGTGTCACCGGAGCTTTTGGATTCATAAC
CTCCCTCATTTCTTGCTACCAGTTGCTTCCGACACGACCCAAGATCAAGGCACCTTGAAGCTTATGGAAGAAAGCTGGCGTTCAAG
CGAAAGTTTGATTGTGTAATACTATGTTGGTCCGTTTGAGTAATTTGCTGCTGTTATTAGTCCTTGCATAAATACTTATCTGCATG
AATGATGATTATAATTAAAAAAAATAATGCCTCAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880194 peroxisomal biogenesis factor 11 family protein [Arabidopsis lyrata subsp. lyrata]11312e-121
NP_566055 peroxisomal membrane protein 11D [Arabidopsis thaliana]11241e-120
XP_002862253 peroxisomal biogenesis factor 11 family protein [Arabidopsis lyrata subsp. lyrata]10281e-109
XP_002511795 peroxisomal biogenesis factor, putative [Ricinus communis]9993e-106
XP_002320762 predicted protein [Populus trichocarpa]9984e-106

Swiss-Prot top hits (Blast detail)Scoree value
O80845 Peroxisomal membrane protein 11D11245e-122
Q9LQ73 Peroxisomal membrane protein 11C9848e-106
Q84JW1 Peroxisomal membrane protein 11E9767e-105
Q10SM7 Peroxisomal membrane protein 11-19014e-096
Q5VRJ8 Peroxisomal membrane protein 11-58558e-091

TrEMBL top hits (Blast detail)Scoree value
B9RDK6 Peroxisomal biogenesis factor, putative9992e-106
A9PJM0 Putative uncharacterized protein9983e-106
B9IC69 Predicted protein9983e-106
A9PC03 Predicted protein9965e-106
B6ZK00 Peroxisomal biogenesis factor 11 family protein9625e-102

Arabidopsis top hits (Blast detail)Scoree value
AT2G45740.1 PEX11D11253e-123
AT2G45740.2 PEX11D11253e-123
AT2G45740.3 PEX11D11253e-123
AT1G01820.1 PEX11C (PEROXIN 11C)9847e-107
AT3G61070.1 PEX11E9775e-106

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  9%
 
75  23%
 
66  27%
 
104  18%
 
124  18%
 
91  5%

Unigene MembersMember information